@ARTICLE{TreeBASE2Ref16648,
author = {Alan W. Meerow and Javier Francisco-Ortega and David N. Kuhn and Raymond J. Schnell},
title = {Phylogenetic Relationships and Biogeography within the Eurasian Clade of Amaryllidaceae Based on Plastid ndhF and nrDNA ITS Sequences: Lineage Sorting in a Reticulate Area?},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {The monophyletic Eurasian clade of Amaryllidaceae was analyzed using plastid ndhF and rDNA ITS sequences for 33 and 29 taxa, respectively, representing all genera by at least one species. Both maximum parsimony and Bayesian analysis were used on each data set and the combined data. Both sequence matrices resolve the Central and East Asian tribe Lycorideae as sister to the Mediterranean-centered genera of the clade, and recognize two large subclades within the greater Mediterranean region: Galantheae, consisting of Acis, Galanthus and Leucojum; and Narcisseae (Narcissus and Sternbergia)/Pancratium. However, there are areas of incongruence between the ndhF and ITS trees. When three predominantly monotypic genera, Hannonia, Lapiedra, and Vagaria, centered in North Africa, are removed from the alignments, the two sequence matrices produce fully congruent topologies with increased support at many of the nodes, with ILD between partitions rising from P = 0.07 to 0.96. We hypothesize that lineage sorting took place after the divergence of Galantheae and Narcisseae/Pancratium from a common genepool of which Hannonia, Lapiedra, and Vagaria have retained a mosaic of the ancestral haplotypes. We also performed dispersal-vicariance analysis to reconstruct biogeographic scenarios on the generic level phylogenies found with and without these three genera included, as well as on a species-level phylogeny of Galantheae. The results of the dispersal-vicariance analysis are discussed in the context of the complex biogeographic history of the Mediterranean basin.}
}
Matrix 1577 of Study 1433
Citation title:
"Phylogenetic Relationships and Biogeography within the Eurasian Clade of Amaryllidaceae Based on Plastid ndhF and nrDNA ITS Sequences: Lineage Sorting in a Reticulate Area?".
This study was previously identified under the legacy study ID S1368
(Status: Published).
Matrices
Title: Eurasian-ndhF
Description: Legacy TreeBASE Matrix ID = M2426
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Worsleya rayneri |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Ungernia flava |
(none)
|
?????????????????????????????? |
Sternbergia sicula |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Sternbergia lutea angustifolia |
(none)
|
?AGTTTCTATGTTAATAGGATTTGGACTTC |
Sternbergia lutea |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Sternbergia greuteriana |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Sternbergia colchicifolia |
(none)
|
????TTCTATGTTAATAGGATTTGGACTCC |
Pancratium zeylanicum |
(none)
|
??????????????ATAGGATTTGGACTTC |
Pancratium tenuifolium |
(none)
|
CAGTTTCTATGTTAATAGGATTTGGACTTC |
Pancratium canariense |
(none)
|
?AGTTTCTATCTTAATAGGATTTGGACTTC |
Narcissus viridiflorus |
(none)
|
????????????TAATAGGATTTGGACTTC |
Narcissus nanus |
(none)
|
??????????????ATAGGATTTGGACTTC |
Narcissus elegans |
(none)
|
??????????????????????????CTTC |
Narcissus calcicola |
(none)
|
????TTCTATGGTAATAGGATTTGGACTTC |
Narcissus alcaracensis |
(none)
|
?????????????????????????????? |
Lycoris aurea |
(none)
|
??????????????ATAGGA-TTGGACTTC |
Acis trichophylla |
(none)
|
??????CTATGTTAATAGGATTTGGACTTC |
Acis tingitana |
(none)
|
??????????????ATAGGATTTGGACTTC |
Acis nicaeensis |
(none)
|
?????????TGTTAATAGGATTTGGACTTC |
Acis autumnalis |
(none)
|
?AGTTTCTATGTTAATAGGATTTGGACTTC |
Leucojum aestivum |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Lapiedra martinezii |
(none)
|
????TTCTATGTTAATAGGATTTGGACTTC |
Hannonia hesperidum |
(none)
|
????????????TAATAGGATTTGGACTTC |
Galanthus woronowii |
(none)
|
??????????????????????????CTGC |
Galanthus reginae olgae |
(none)
|
??????????GTT-ATAGGATTTGGACTTC |
Galanthus plicatus plicat |
(none)
|
??????CTATGTTAATAGGATTTGGACTTC |
Galanthus plicatus byzant |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Galanthus peshmenii |
(none)
|
?????TCTATGTTAATAGGATTTGGACTTC |
Galanthus nivalis |
(none)
|
?????????TGTT-ATAGGATTTGGACTTC |
Galanthus ikariae |
(none)
|
????TTCTATGTTAATAGGATTTGGACTTC |
Cyrtanthus herrei |
(none)
|
???????TATG-TAATAGGATTTGGACTTC |
Lycoris squamigera |
(none)
|
?????????????????????????????? |
Vagaria ollivieri |
(none)
|
??????????????????????GGGACTTC |
Columns
None of the columns has a description.