@ARTICLE{TreeBASE2Ref21764,
author = {Dengmei Fan and Jipei Yue and Ze-Long Nie and Zhimin Li and Hans Peter Comes and Hang Sun},
title = {Phylogeography of Sophora davidii (Leguminosae) across the "Tanaka-Kaiyong Line", an important phytogeographic boundary in Southwest China},
year = {2013},
keywords = {chloroplast DNA, China, nuclear DNA, phylogeography, Sophora davidii, Tanaka-Kaiyong Line},
doi = {},
url = {http://},
pmid = {},
journal = {Molecular Ecology},
volume = {},
number = {},
pages = {},
abstract = {The "Tanaka-Kaiyong Line" (TKL) is a major phytogeographic boundary in Southwest China, separating East Asia?s Sino-Himalayan and Sino-Japanese Floras. However, little is known about the importance of this boundary in promoting intra-specific phylogeographic subdivision and divergence. Using chloroplast (cpDNA) and nuclear-intron (nDNA) sequence data, we reconstructed the population history of Sophora davidii, a drought-tolerant riparian shrub widely distributed on either side of the TKL. Specifically, we aimed at testing two long-standing explanations for possible vicariant events across the TKL: (1) Late Pliocene (c. 3 Ma) geological uplift of the eastern Qinghai-Tibetan Plateau; or (2) a sharp environmental gradient associated with the establishment of different monsoon regimes on either side of the TKL during the (Late) Pleistocene. Our genealogical analyses detected a major west-east split in cpDNA, geographically largely consistent with the TKL, and dated to the Pleistocene [c. 1.28 Ma (95% HPD: 0.21?2.96 Ma)]. Furthermore, integrating cpDNA phylogeographic patterns with mismatch analyses, we found multiple refugial isolation and long-term demographic stability of populations in the west (Hengduan Mountain Range) compared to extensive range expansions in the east, possibly during the last glacial period(s), and followed by differentiation into regional sub-lineages (southeast: Yunnan-Guizhou Plateau vs. northeast: Qinling Mts./Loess Plateau). Although nuclear differentiation was less marked, the geographical pattern of nDNA haplotypes provided some further indication of the species? eastward expansion, possibly from source populations located just east of the TKL (Lower Jinshajiang region). Overall, the present data reject the geological (tectonic) explanation for the TKL and, instead, provide supportive evidence for its role as a climatically driven barrier to present-day plant dispersal. In addition, our study highlights changing temperatures and vegetation types during the last glacial period(s), along with aspects of regional topography, to be important determinants of the glacial eastward expansion of S. davidii. In consequence, our study lends support to a ?glacial out-of-Hengduan Mts.? hypothesis for the xerophytic-riparian flora of Southwest China, which in turn is inconsistent with the traditional view of the TKL as a ?classical? vicariant-biogeographic boundary.}
}
Matrix 16452 of Study 13583
Citation title:
"Phylogeography of Sophora davidii (Leguminosae) across the "Tanaka-Kaiyong Line", an important phytogeographic boundary in Southwest China".
Study name:
"Phylogeography of Sophora davidii (Leguminosae) across the "Tanaka-Kaiyong Line", an important phytogeographic boundary in Southwest China".
This study is part of submission 13583
(Status: Published).
Matrices
Title: cpDNA haplotype matrix for beast analysis (without repetitive regions)
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Sophora davidii C1 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C12 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C14 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C15 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C16 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C17 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C18 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C19 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C2 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C20 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C21 |
(none)
|
TTGAAATCATAATAACCGATTTTGAGTCAA |
Sophora davidii C22 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C3 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C4 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C5 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C6 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C7 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C8 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Sophora davidii C9 |
(none)
|
TTGAAATCATAATAACCGATTTTTAGTCAA |
Columns
None of the columns has a description.