@ARTICLE{TreeBASE2Ref23040,
author = {Vy Xuan Nguyen and Matsapume Detcharoen and Piyalap Tuntiprapas and U Soe-Htun and Japar Sidik and Muta Harah and Anchana Prathep and Jutta Papenbrock},
title = {Genetic species identification and population structure of Halophila (Hydrocharitaceae) from the Western Pacific to the Eastern Indian Ocean},
year = {2014},
keywords = {Eastern Indian Ocean, evolution, genetic distance, Halophila ovalis, Western Pacific Ocean},
doi = {10.1186/1471-2148-14-92},
url = {http://biomedcentral.com/1471-2148/14/92/abstract},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {14},
number = {},
pages = {},
abstract = {The Indo-Pacific region has the largest number of seagrass species worldwide and this region is considered as the origin of the Hydrocharitaceae. Halophila ovalis and its closely-related species belonging to the Hydrocharitaceae are well-known as a complex taxonomic challenge mainly due to their high morphological plasticity. However, arguments on taxonomy based on morphology of H. ovalis and Halophila major have not been clarified among scientists. The relationship of genetic differentiation and geographic barriers of H. ovalis radiation, as well as its further evolution, was not much studied in this region yet. Are there misidentifications between H. ovalis and its closely related species? Does any taxonomic uncertainty among different populations of H. ovalis persist? Is there any genetic differentiation among populations in the Western Pacific and the Eastern Indian Ocean, which are separated by the Thai-Malay peninsula? Genetic markers can be used to characterize and identify individuals or species and will be used to answer these questions.
Phylogenetic analyses of the nuclear ribosomal internal transcribed spacer region based on materials collected from 17 populations in the Western Pacific and the Eastern Indian Ocean showed that some specimens identified as H. ovalis belonged to the H. major clade with bootstrap values higher than 90%, which was also supported by morphological data. Evolutionary divergence between the two clades is between 0.033 and 0.038, much higher than the evolutionary divergence among H. ovalis populations. Eight haplotypes were found; none of the haplotypes from the Western Pacific is found in India and vice versa. Analysis of genetic diversity based on microsatellite analysis revealed that the genetic diversity in the Western Pacific is higher than in the Eastern Indian Ocean. Skatlin?s genetic distances among populations from the Western Pacific were shorter than between populations from the Western Pacific and the Eastern Indian Ocean and vice versa. The unrooted neighbor-joining tree among 14 populations from the Western Pacific and the Eastern Indian Ocean showed six main groups. The Mantel test results revealed a significant correlation between genetic and geographic distances among populations. Results from band-based and allele frequency-based approaches from Amplified Fragment Length Polymorphism showed that all samples collected from both sides of the Thai-Malay peninsula were clustered into two clades: Gulf of Thailand and Andaman Sea.
Our study documented the new records of H. major for Malaysia and Myanmar. The study also revealed that the Thai-Malay peninsula is a geographic barrier between H. ovalis populations in the Western Pacific and the Eastern Indian Ocean.
}
}
Matrix 21527 of Study 15597
Citation title:
"Genetic species identification and population structure of Halophila (Hydrocharitaceae) from the Western Pacific to the Eastern Indian Ocean".
Study name:
"Genetic species identification and population structure of Halophila (Hydrocharitaceae) from the Western Pacific to the Eastern Indian Ocean".
This study is part of submission 15597
(Status: Published).
Matrices
Title: Halophila ITS Alignment
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Halophila decipiens KC175913 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila minor AF366405 |
(none)
|
CGTGACGAGCTCGAGCCGGGGCGAGGAATC |
Halophila minor AF366406 |
(none)
|
CGTGACGAGCTCGAGCCGGGGCGAGGAATC |
Halophila major Hap. 13 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila major AB436929 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila major KC175910 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila major Hap. 5 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila major Hap. 4 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila major Hap. 16 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGAGGAATC |
Halophila ovalis Hap. 6 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 12 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 14 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 9 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 11 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 15 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis KC175912 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis KC175911 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis KC175908 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis KC175909 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 17 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 18 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 19 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 1 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 10 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 3 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 2 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 8 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Halophila ovalis Hap. 7 |
(none)
|
CGTGACGAGCTCGAGTCGGGGCGGGGAATC |
Columns
None of the columns has a description.