CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 2153 of Study 554

Reviewer/Referee Access Agreement

You have reached this page using a special URL that is intended to be used by journal editors and reviewers or referees of a paper that is under consideration for publication. This URL gives you access to the submitted data and metadata associated with analyses and results presented in the paper under review. Please carefully examine the data paying special attention to the following:
  • The citation data (authors, year, citation, abstract) should be complete, except for information that is not yet known (e.g. volume or page numbers).
  • Verify that nexus files are error-free and executable by software programs (e.g. PAUP, Mesquite, MacClade, etc). Please make sure that the taxon labels for trees are identical, or a subset of, the taxon labels in data matrices connected by way of an analysis. If taxon labels in trees do not match with taxon labels in associated data matrices, the data will not be useful to the scientific community.
  • Verify that data are not missing and that opportunities to supply valuable metadata are not overlooked. For example, TreeBASE can store Genbank accession numbers, museum voucher IDs, latitude and longitudes for specimen localities, character names and character state names for morphological data, etc. Including these metadata are sometimes overlooked by submitting authors, yet sharing this metadata is extremely valuable to the scientific community. Please use your power as a reviewer to encourage the sharing of richly-annotated metadata.
  • Verify that analyses are not missing and that, where possible, analysis entries include software commands (e.g. the contents of a PAUP block or MrBayes block) so that analyses can be replicated easily (e.g. commands that describe substitution models, data partitions, and heuristic search parameters).
  • Verify that taxon labels are mapped against TreeBASE's taxonomic dictionary. Data in TreeBASE can only be found using a taxon name search if the taxon labels are properly mapped.
By clicking the 'OK' button below, you agree to keep these data confidential; you agree not to retain these data after completing your report to the journal editor; you agree not to use these data or knowledge of these data for the purposes of your research until and unless the paper under review has been published and the data have been made available to the general public; you agree to keep the URL confidential.
About Citation title: "Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences.".
About This study was previously identified under the legacy study ID S378 (Status: Published).

Matrices

Title: gpd

Description: Legacy TreeBASE Matrix ID = M522

Rows

Taxon Label Row Segments Characters 1?–30
Stemphylium botryosum  (none) TATCGTCTTCCGCAATGCGT-A-GT-----
Stemphylium alfalfae  (none) TATCGTCTTCCGCAATGCGT-AAGT-----
Setosphaeria rostrata  (none) TATCGTCTTCCGCAATGCGT-AGGTGCC--
Setosphaeria monoceras  (none) TATCGTCTTCCGCAATGCGT-AGGTGCCCC
Setosphaeria minor  (none) TATCGTCTTCCGCAATGCGT-AGGTGTCC-
Pyrenophora japonica  (none) --TCGTCTTCCGCAACGCGT-ACGTACTC-
Curvularia gudauskasii  (none) TATCGTCTTCCGCAATGCGT-AGGTGCTCC
Curvularia gladioli  (none) TATCGTCTTCCGCAATGCGT-AGGTGCTC-
Curvularia clavata  (none) TATCGTCTTCCGCAATGCGT-AGGTGCTCC
Curvularia affinis  (none) TATCGTCTTCCGCAATGCGT-ACGTCTTC-
Cochliobolus victoriae Macko 40  (none) TATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus victoriae HV033  (none) TATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus victoriae HV013  (none) TATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus verruculosus ..541  (none) TATCGTCTTCCGCAATGCGT-AAGTGTTC-
Cochliobolus verruculosus ..540  (none) TATCGTCTTCCGCAATGCGT-AAGTGTTC-
Cochliobolus sativus  (none) TATCGTCTTCCGCAATGCGT-A-GTACC--
Cochliobolus ravenelii  (none) CATCGTCTTCCGCAATGCGT-AGGTGTTCC
Cochliobolus perotidis Al7846-5  (none) TATCGTCTTCCGCAATGCGTCAGGTGTTCC
Cochliobolus perotidis Al7846-2  (none) TATCGTCTTCCGCAATGCGTCAGGTGTTCC
Cochliobolus peregianensis  (none) CATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus nisikadoi  (none) TATCGTCTTCCGCAATGCGT-ACGTCTTC-
Cochliobolus miyabeanus  (none) CATCGTCTTCCGCAATGCGT-AAGTACCC-
Cochliobolus melinidis Al8747  (none) CATCGTCTTCCGCAATGCGT-GAGTACC--
Cochliobolus melinidis Al8795  (none) CATCGTCTTCCGCAATGCGT-GAGTACC--
Cochliobolus luttrellii  (none) CATCGTCTTCCGCAATGCGT-AGGTACC--
Cochliobolus lunatus X58718  (none) TATCGTCTTCCGCAATGCGT-AGGTGTCC-
Cochliobolus lunatus UAMH 4378  (none) TATCGTCTTCCGCAATGCGT-AGGTGTTTC
Cochliobolus lunatus UAMH 1349  (none) TATCGTCTTCCGCAATGCGT-AGGTGTTTC
Cochliobolus kusanoi  (none) TATCGTCTTCCGCAATGCGT-AGGTGCC--
Cochliobolus intermedius..797-3  (none) TATCGTCTTCCGCAATGCGT-AGGTGCTTC
Cochliobolus intermedius..797-1  (none) TATCGTCTTCCGCAATGCGT-AGGTGCTTC
Cochliobolus homomorphus  (none) TATCGTCTTCCGCAATGCGT-ATGTACC--
Cochliobolus heterostrophus X63  (none) CATCGTCTTCCGCAATGCGT-AAGTACCC-
Cochliobolus heterostrophus HM8  (none) CATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus heterostrophus HM3  (none) CATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus heterostrophus HAW  (none) CATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus heterostrophus C5  (none) CATCGTCTTCCGCAATGCGT-AAGTACC--
Cochliobolus hawaiiensis Al8747  (none) TATCGTCTTCCGCAATGCGT-AGGTGTCC-
Cochliobolus hawaiiensis Al7612  (none) TATCGTCTTCCGCAATGCGT-AGGTGTCC-
Cochliobolus ellisii  (none) TATCGTCTTCCGCAATGCGT-ATGTGTCC-
Cochliobolus eleusines  (none) TATCGTCTTCCGCAATGCGT-AAGTATCC-
Cochliobolus dactyloctenii  (none) TATCGTCTTCCGCAATGCGT-AGGTGTTC-
Cochliobolus cymbopogonis  (none) TATCGTCTTCCGCAATGCGT-ACGTCTTC-
Cochliobolus carbonum  (none) TATCGTCTTCCGCAATGCGT-A-GTACC--
Cochliobolus australiensis  (none) TATCGTCTTCCGCAATGCGT-AGGTGTCC-
Bipolaris australis  (none) TATCGTCTTCCGCAATGCGT-AGGTGTTC-
Bipolaris zeae  (none) TATCGTCTTCCGCAATGCGT-AAGTA-CC-
Bipolaris urochloae  (none) CATCGTCTTCCGCAATGCGT-AAGTACC--
Bipolaris sorghicola  (none) CATTGTCTTCCGCAATGCGT-AAGTACC--
Bipolaris sacchari  (none) CATCGTCTCCCGCAATGCGT-AAGTACC--
Bipolaris indica  (none) TATCGTCTTCCGCAATGCGT-AGGTGCCC-
Alternaria alternata  (none) TATCGTCTTCCGCAATGCGT-AAGT-----
Pyrenophora tritici-repentis  (none) TATCGTCTTCCGCAACGCGT-ACGTACTC-
Stemphylium herbarum  (none) TATCGTCTTCCGCAATGCGT-A-GT-----

Columns

None of the columns has a description.