@ARTICLE{TreeBASE2Ref16338,
author = {Jianhua Li and Michael J Donoghue and D. E. Boufford},
title = {Phylogenetics of Buckleya (Santalaceae) based on ITS sequences of nrDNA},
year = {2001},
keywords = {biogeography; Bucleya; Santalaceae; ITS; phylogeny; molecular clock},
doi = {},
url = {http://www.phylodiversity.net/donoghue/publications/MJD_papers/2001/105_Li_Rhodora01.pdf},
pmid = {},
journal = {Rhodora},
volume = {103},
number = {914},
pages = {137--150},
abstract = {Buckleya (Santalaceae) is a hemi-parasitic, shrubby genus with two species in China, one in Japan, and one in the southeastern United States. Phylogenetic relationships among these species are controversial and have not been tested using molecular data. In this study we used sequences of the internal transcribed spacer region of nuclear ribosomal DNA to test previous phylogenetic hypotheses. Two sister species pairs are well supported: B. distichophylla plus B. graebneriana, and B. lanceolata plus B. henryi. Sequence differences and morphological characters support the recognition of B. lanceolata and B. henryi. Sequence divergence between B. distichophylla and B. graebneriana is twice as high as that between B. lanceolata and B. henryi. These results are most consistent with the treatment proposed by Carvell and Eshbaugh. Biogeographically, one of the Chinese species (B. graebneriana) is most closely related to the eastern North American species (B. distichophylla), while the other Chinese species (B. henryi) is allied with the Japanese species (B. lanceolata). Maximum likelihood analyses do not reject clock-like evolution of nrDNA ITS spacers in Buckleya, and divergence times may date to the Late Miocene and Pliocene.}
}
Matrix 2259 of Study 680
Citation title:
"Phylogenetics of Buckleya (Santalaceae) based on ITS sequences of nrDNA".
This study was previously identified under the legacy study ID S519
(Status: Published).
Matrices
Title: ITS
Description: Legacy TreeBASE Matrix ID = M753
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Thesium impeditum |
(none)
|
TCGA-AACCTGCCTAGCAGGGTGACCCGCG |
Buckleya henryi 3 |
(none)
|
TTGAGAACCTGCTAAGCAGGATGACCGGTG |
Buckleya henryi 1 |
(none)
|
TTGAGAACCTGCTAAGCAGGATGACCGGTG |
Buckleya graebneriana 2 |
(none)
|
TTGA-AACCTGCTAAGCAGGATGACCGGTG |
Buckleya henryi 2 |
(none)
|
TTGAGAACCTGCTAAGCAGGATGACCGGTG |
Buckleya lanceolata 1 |
(none)
|
ATGAGAACCTGCTAAGCAGGATGACCGGTG |
Buckleya graebneriana 1 |
(none)
|
TTGA-AACCTGCTAAGCAGGATGACCGGTG |
Buckleya lanceolata 2 |
(none)
|
ATGAGAACCTGCTAAGCAGGATGACCGGTG |
Buckleya lanceolata 3 |
(none)
|
ATGAGAACCTGCTAAGCAGGATGACCGGTG |
Buckleya distichophylla |
(none)
|
TTGA-AACCTGCTAAGCAGGATGACCGGTG |
Columns
None of the columns has a description.