@ARTICLE{TreeBASE2Ref15674,
author = {L. D. Guo and Kevin D Hyde and Edward C. Y. Liew},
title = {Detection and taxonomic placement of endophytic fungi within frond tissues of Livistona chinensis based on rDNA sequences.},
year = {2001},
keywords = { molecular identi?cation; molecular phylogenetics; environmental DNA; mycelia sterilia; ribosomal RNA gene},
doi = {10.1006/mpev.2001.0942},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {20},
number = {1},
pages = {1--13},
abstract = {The 5.8S gene and flanking internal transcribed spacers (ITS1 and ITS2) of the rDNA were amplified from total DNA extracted from frond tissues of Livistona chinensis using universal and fungal specific primers. These amplified fragments were cloned and sequenced. Phylogenetic analysis based on the 5.8S gene sequences indicated that the six clone sequences obtained were of different origins. Five sequences, P1-9, P2-6, P4-4, P4-5, and P4-7, belonged to the fungi and one sequence, P3-2, belonged to the plants. P1-9 was inferred to belong to the Basidiomycota based on the phylogenetic analysis of the 5.8S gene sequences but could not be identified to lower taxonomic levels. Further identification of the other four fungal clones to lower taxonomic levels were conducted based on phylogenetic analysis and sequence comparison of both the conserved 5.8S gene and the variable ITS regions. The origin of P2-6 was identified to be Glomerella and its anamorph Colletotrichum; the origins of P4-5 and P4-7 were Mycosphaerella and its anamorph Cladosporium; while P4-4 was from the Herpotrichiellaceae. The direct approach to detecting and taxonomic placement of endophytic fungi within host tissue without the need for conventional in vitro culturing is discussed.}
}
Matrix 2268 of Study 683
Citation title:
"Detection and taxonomic placement of endophytic fungi within frond tissues of Livistona chinensis based on rDNA sequences.".
This study was previously identified under the legacy study ID S522
(Status: Published).
Matrices
Title: ITS1 5.8S ITS2 with P4-5 P4-7
Description: Legacy TreeBASE Matrix ID = M761
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Phaeosphaeria avenaria |
(none)
|
TCAGTAGTTTACTACTGTAAAGGAGGCTGT |
Ophiosphaerella herpotricha |
(none)
|
TCCGTAGGTGAACCTGCGGAAGGATCATTA |
Pleospora herbarum |
(none)
|
-----------------CACAATATGAAAG |
Dothidea hippophaeos |
(none)
|
---AAGATTGAGTGTCGCGACCTAAAAAAT |
Phaeocryptopus gaeumannii |
(none)
|
---AAGAGTAAGGGTTATT-CGTAG----- |
Elsino? australis |
(none)
|
---ACGAGGAAGGGTT-T--CCGAAAGGAG |
Cladosporium tenuissimum |
(none)
|
----CAAGT-GACCCCGG--TCTAA-CCAC |
Cladosporium cladosporioides |
(none)
|
----CAAGT-GACCCCGG--TCTAA-CCAC |
Cladosporium sp. |
(none)
|
------AGT-GACCCCGG--TTTC--CCAC |
Cladosporium herbarum |
(none)
|
----CAAGA-ACGCCCGG--GCTT--CGGC |
Cladosporium oxysporum |
(none)
|
----CAAGA-ACGCCCGG--GCTT--CGGC |
Cladosporium sphaerospermum |
(none)
|
----CAAGTTGACACCCG--CCCTC-GGTC |
P4-5 |
(none)
|
------CCTCGGGGAGAG--GG----CGGG |
Cladosporium fulvum |
(none)
|
-------CTGAGTGAGGG--C-T---CACG |
P4-7 |
(none)
|
-----AAGAGATGGCGGG--CCTCG-CTGC |
MS594 |
(none)
|
---CCGAGCGAAGGGGCG--CC-CG-C-GC |
Mycosphaerella graminicola |
(none)
|
-------CCGAGCGAGGG--CCTC--CGGG |
Botryosphaeria dothidea |
(none)
|
---CCGAGTTGATTCGGG--C-T---CCGG |
Saccharomyces cerevisiae |
(none)
|
ACGGTGAGAGATTTC---TGTGCTTTTGTT |
Torulaspora delbrueckii |
(none)
|
GGGGCTTCTGTATTC---ACTGTTTCTCTG |
Candida glabrata |
(none)
|
TGGATCTCTCTATTCCAAAGAGGTGTTTTA |
Columns
None of the columns has a description.