@ARTICLE{TreeBASE2Ref15122,
author = {Pedro W. Crous and Cony Decock and Conrad Lamoraal Schoch},
title = {Xenocylindrocladium guianense and X. subverticillatum, two new species of hyphomycetes from plant debris in the tropics.},
year = {2001},
keywords = {Cylindrocladium; Hypocreales; saprobe; Xenocylindrocladium},
doi = {10.1007/BF02460955},
url = {},
pmid = {},
journal = {Mycoscience},
volume = {42},
number = {},
pages = {559--566},
abstract = {Two new species of hyphomycetes, Xenocylindrocladium guianense and X. subverticillatum, are described from plant debris collected in French Guiana and Singapore, respectively. The genus Xenocylindrocladium has thus far been known from one species, X. serpens, which was described from plant debris collected in Ecuador. The two new taxa are compared with and distinguished from X. serpens based on morphology, cultural characteristics and phylogenetic analysis of DNA sequence data of the 5.8S rDNA with flanking ITS1 and ITS2 regions and the 5' end of the b-tubulin gene. These species are also compared with other closely related hypocrealean taxa. Present collection data suggest that species of Xenocylindrocladium could be restricted to the tropics. }
}
Matrix 2287 of Study 718
Citation title:
"Xenocylindrocladium guianense and X. subverticillatum, two new species of hyphomycetes from plant debris in the tropics.".
This study was previously identified under the legacy study ID S562
(Status: Published).
Matrices
Title: beta tubulin gene fragment
Description: Legacy TreeBASE Matrix ID = M851
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Xenocylindrocladium guianense STEU 3397 |
(none)
|
CGCGGTGCTTTGTTACTGCCCCTGATTCTA |
Xenocylindrocladium guianense STEU 3396 |
(none)
|
CGCGGTGCTTTGTTGCTGCCCCTGATTCTA |
Xenocylindrocladium subverticillatum STEU 3397 |
(none)
|
???????????GTTGCTGCCCCTGATTCTA |
Xenocylindrocladium serpens STEU 1144 |
(none)
|
?GCGCTGCTTGGCTGCTGCCCCTGATTCTA |
Gliocladiopsis tenuis IMI 300597 |
(none)
|
???????????GTCGCTGCCCCTGATTCTA |
Cylindrocladium scoparium ATCC 46300 |
(none)
|
?GCGTGCCTTGGTTGCTGCCCCTGATTCTA |
Cylindrocladium floridanum ATCC 18882 |
(none)
|
?GCGTGCCTTTGTTGCTGCCCCTGAGCGTA |
Curvicladium cigneum STEU 1595 |
(none)
|
???????????GTTGCTACCCCTGATTCTA |
Cylindrocladiella microcylindrica ATCC 38571 |
(none)
|
?????????????????????????????? |
Cylindrocladiella infestans ATCC 44816 |
(none)
|
??????????????GCTGCCCCT{CG}ATT |
Fusarium subglutinans NRRL 22016 |
(none)
|
CGCGTTGAGTTTATGGTGCCCCTGATTCTA |
Columns
None of the columns has a description.