@ARTICLE{TreeBASE2Ref19011,
author = {A. Jonathan Shaw and Cymon John Cox and William R. Buck and Nicolas Devos and Alex Buchanan and Lynette Cave and Rod Seppelt and Blanka Shaw and Juan Larra?n and Richard Andrus and Johann Greilhuber and Eva Temsch},
title = {Newly resolved relationships in an early land plant lineage: Bryophyta class Sphagnopsida (peat mosses)},
year = {2010},
keywords = { Ambuchanania; bryophyte phylogeny; land plant phylogeny; peat mosses; Sphagnopsida; Sphagnum},
doi = {10.3732/ajb.1000055},
url = {http://},
pmid = {21616905},
journal = {American Journal of Botany},
volume = {97},
number = {9},
pages = {1511--1531},
abstract = {Premise of the study: The Sphagnopsida, an early-diverging lineage of mosses (phylum Bryophyta), are morphologically and ecologically unique and have profound impacts on global climate. The Sphagnopsida are currently classified in two genera, Sphagnum (peat mosses) with some 350?500 species and Ambuchanania with one species. An analysis of phylogenetic relationships among species and genera in the Sphagnopsida were conducted to resolve major lineages and relationships among species within the Sphagnopsida. Methods: Phylogenetic analyses of nucleotide sequences from the nuclear, plastid, and mitochondrial genomes (11 704 nucleotides total) were conducted and analyzed using maximum likelihood and Bayesian inference employing seven different substitution models of varying complexity. Key results: Phylogenetic analyses resolved three lineages within the Sphagnopsida: (1) Sphagnum sericeum, (2) S. inretortum plus Ambuchanania leucobryoides, and (3) all remaining species of Sphagnum. Sister group relationships among these three clades could not be resolved, but the phylogenetic results indicate that the highly divergent morphology of A. leucobryoides is derived within the Sphagnopsida rather than plesiomorphic. A new classification is proposed for class Sphagnopsida, with one order (Sphagnales), three families, and four genera. Conclusions: The Sphagnopsida are an old lineage within the phylum Bryophyta, but the extant species of Sphagnum represent a relatively recent radiation. It is likely that additional species critical to understanding the evolution of peat mosses await discovery, especially in the southern hemisphere.}
}
Matrix 23158 of Study 10591
Citation title:
"Newly resolved relationships in an early land plant lineage: Bryophyta class Sphagnopsida (peat mosses)".
Study name:
"Newly resolved relationships in an early land plant lineage: Bryophyta class Sphagnopsida (peat mosses)".
This study is part of submission 10581
(Status: Published).
Matrices
Title: Sphagnopsida Shaw et al 2010 9x11
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Ambuchanania leucobryoides |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Andreaea wilsonii |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Sphagnum lapazense |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Sphagnum lescurii |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Sphagnum palenae |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Sphagnum palustre |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Sphagnum sericeum 1239 |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Sphagnum sericeum 858 |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Takakia lepidozioides |
(none)
|
AAGATTAAGCCATGCATGTGTAAGTATAAA |
Columns
None of the columns has a description.