@ARTICLE{TreeBASE2Ref17834,
author = {Mats Thulin and Matthew T. Lavin and Remy Pasquet and Alfonso Delgado-Salinas},
title = {Phylogeny and Biogeography of Wajira (Leguminosae): A Monophyletic Segregate of Vigna Centered in the Horn of Africa Region.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = { Evidence from chloroplast trnK and nuclear ribosomal ITS sequences and morphological data reveals that the monotypic legume genus Wajira is nested within a clade comprising the species of Vigna subgen. Macrorhynchus. This Wajira-containing clade is basally branching in a larger clade that contains many of the genera traditionally referred to as tribe Phaseoleae subtribe Phaseolinae. Wajira is thus recircumscribed to include Vigna subgen. Macrorhynchus. Given the heterogeneity of floral morphology of its constituent species, Wajira now is apomorphically diagnosed by only its pollen brush, which comprises an introrse linear array of unicellular hairs. This recircumscribed genus now comprises five species, one of which is described as new, Wajira danissana. Three species require new nomenclatural combinations, Wajira grahamiana, Wajira praecox, and Wajira virescens. Parsimony analysis of the combined ITS and trnK sequence data weakly supports a sister relationship of the widespread W. grahamiana, which occurs in the Sudano-Zambezian Region, southern India, and Sri Lanka, with the remaining four species each narrowly distributed in the Somalia-Masai Region. Wajira grahamiana occurs in grasslands subjected to seasonal burning and has a thick and woody subterranean rootstock that resprouts herbaceous annual shoots. The four species of the Somalia-Masai clade are all woody climbers that occur in arid regions with sparse ground cover not subjected to seasonal burning. An evolutionary rates analysis of trnK sequences suggests that the Wajira stem clade diverged from its closest relatives about 10-12 million years ago, the extant diversification of the genus began around 5-6 million years ago, and Wajira grahamiana attained its widespread distribution well within the last 2 million years.}
}
Matrix 2468 of Study 1165
Citation title:
"Phylogeny and Biogeography of Wajira (Leguminosae): A Monophyletic Segregate of Vigna Centered in the Horn of Africa Region.".
This study was previously identified under the legacy study ID S1072
(Status: Published).
Matrices
Title: ITS trnK
Description: Legacy TreeBASE Matrix ID = M1828
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Wajira praecox 1496 |
(none)
|
?????????????????????????????? |
Wajira grahamiana 1755 |
(none)
|
?????????????????????????????? |
Wajira grahamiana 1746 |
(none)
|
?????????????????????????????? |
Wajira grahamiana 1624 |
(none)
|
?????????????????????????????? |
Wajira grahamiana 1623 |
(none)
|
TTACGCATTTCTATGAAGCAATCGGTTCGT |
Wajira grahamiana 1621 |
(none)
|
???????????????????????GGTTCGT |
Wajira danissana 1487 |
(none)
|
?????????????????????????????? |
Wajira danissana 1172 |
(none)
|
?????????????????????????????? |
Wajira albescens |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Vigna unguiculata |
(none)
|
??ACGCATTTCTATGAAGCAATGGGTTCGT |
Vigna trichocarpa |
(none)
|
?????????????????????????????? |
Vigna spectabilis |
(none)
|
???CACATTTCTATGAAGCAATCGGTTCGT |
Vigna peduncularis |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Vigna luteola |
(none)
|
TTACACATTTCTATGAAGCAATAAGTTCGT |
Vigna longifolia |
(none)
|
??ACACATTTCTATGAAGCAATTGGTTCAT |
Vigna lasiocarpa |
(none)
|
TTACACATTTCTATGAAGCAATTGGTTCAT |
Vigna adenantha |
(none)
|
????????????ATGAA?CAATCGGT?CGT |
Sphenostylis angustifolia |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Ramirezella strobilophora |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Physostigma venenosum |
(none)
|
?????????????????????????????? |
Oxyrhynchus volubilis |
(none)
|
TTACACATTTCTATGAAGCAATTGGTTCGT |
Macrotyloma daltonii |
(none)
|
?????????????????????????????? |
Lablab purpureus |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Dolichos trilobus |
(none)
|
?????????????????????????????? |
Dipogon lignosus |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Cologania hintoniorum |
(none)
|
TTACACATTTCTATGAAGCAATCGGTTCGT |
Wajira virescens |
(none)
|
?????????????????????????????? |
Wajira praecox 1498 |
(none)
|
?????????????????????????????? |
Wajira praecox 1497 |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.