@ARTICLE{TreeBASE2Ref16118,
author = {Karin Kiontke and Nicholas P. Gavin and Yevgeniy Raynes and Casey Roehrig and Fabio Piano and David H. A. Fitch},
title = {Caenorhabditis phylogeny predicts convergence of hermaphroditism and extensive intron loss.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {},
number = {},
pages = {},
abstract = {Despite the prominence of Caenorhabditis elegans as a major developmental and genetic model system, its phylogenetic relationship to its closest relatives has not been resolved. Resolution of these relationships is necessary for studying the steps that underlie life history, genomic, and morphological evolution of this important system. Using data from five different nuclear genes from 10 Caenorhabditis species currently in culture, we find a well-resolved phylogeny that reveals three striking patterns in the evolution of this animal group: (1) hermaphroditism has evolved independently in C. elegans and its close relative C. briggsae; (2) there is a large degree of intron turnover within Caenorhabditis and intron losses are much more frequent than intron gains; and (3) despite the lack of marked morphological diversity, more genetic disparity is present within this one genus than has occurred within all vertebrates.}
}
Matrix 2506 of Study 1185
Citation title:
"Caenorhabditis phylogeny predicts convergence of hermaphroditism and extensive intron loss.".
This study was previously identified under the legacy study ID S1094
(Status: Published).
Matrices
Title: Five Genes
Description: Legacy TreeBASE Matrix ID = M1869
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Caenorhabditis briggsae |
(none)
|
ATTCCATTCGGTTTCCGTCACCGCACGCTT |
Caenorhabditis remanei |
(none)
|
?????????????????????????????? |
Caenorhabditis sp CB5161 |
(none)
|
?????????????????????????????? |
Caenorhabditis elegans |
(none)
|
ATTCCATTCGGTTTCCGTCATCGTACACTT |
Caenorhabditis japonica |
(none)
|
?????????????????????????????? |
Caenorhabditis sp PS1010 |
(none)
|
ATTCCATTCGGATTCCGTCATCGAACACTT |
Caenorhabditis drosophilae |
(none)
|
ATTCCGTTTGGGTTCAGACATCGTACATTG |
Caenorhabditis sp DF5070 |
(none)
|
?????????????????????????????? |
Caenorhabditis plicata |
(none)
|
ATTCCGTTTGGTTTTCGCCATCGAACGCTC |
Caenorhabditis sp SB341 |
(none)
|
ATTCCGTTTGGGTTCCGTCACCGCACGCTG |
Prodontorhabditis wirthi |
(none)
|
ATTCCGTTTGGGTTCAGACATCGAACGTTA |
Protorhabditis sp DF5055 |
(none)
|
?????????????????????????????C |
Oscheius myriophila |
(none)
|
?????????????????????????????? |
Rhabditella axei |
(none)
|
ATTCCGTTTGGATTCCGTCACAGAACGTTG |
Columns
None of the columns has a description.