@ARTICLE{TreeBASE2Ref14854,
author = {Thomas D. Bruns and T. M. Szaro},
title = {Rate and mode differences between nuclear and mitochondrial small-subunit rRNA genes in mushrooms.},
year = {1992},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Biology and Evolution},
volume = {9},
number = {},
pages = {836--855},
abstract = {Sequences from homologous regions of the nuclear and mitochondrial small-subunit rRNA genes from 10 members of the mushroom order Boletales were used to construct evolutionary trees and to compare the rates and modes of evolution. Trees constructed independently for each gene by parsimony and tested by bootstrap analysis have identical topologies in all statistically significant branches. Examination of base substitutions revealed that the nuclear gene is biased toward C-T transitions and that the distribution of transversions in the mitochondrial gene is strongly effected by an A-T bias. When only homologous regions of the two genes were compared, base substitutions per nucleotide were roughly 16-fold greater in the mitochondrial gene. The difference in the frequency of length mutations was at least as great but was impossible to estimate accurately because of their absence in the nuclear genc. Maximum likelihood was used to show that base-substitution rates vary dramatically among the branches. A significant part of the rate inconstancy was caused by an accelerated nuclcar rate in one branch and a retarded mitochondrial rate in a different branch. A second part of the rate variability involved a consistent inconstancy: short branches exhibit ratios of mitochondrial to nuclear divergences of <1, while longer branches had ratios of ~4.1-8.1. This pattern suggests a systematic error in the branch length calculation. The error may be related to the simplicity of the divergence estimates, which assumes that all base positions have an equal probability of change.}
}
Matrix 2551 of Study 284
Citation title:
"Rate and mode differences between nuclear and mitochondrial small-subunit rRNA genes in mushrooms.".
This study was previously identified under the legacy study ID S3x27x98c14c34c15
(Status: Published).
Matrices
Title: Table
Description: Legacy TreeBASE Matrix ID = M191c3x27x98c14c36c42
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Suillus cavipes |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Suillus sinuspaulianus |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Rhizopogon subcaerulescens |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Chroogomphus vinicolor |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Gomphidius glutinosus |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Paxillus atrotomentosus |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Paragyrodon sphaerosporus |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Phylloporus rhodoxanthus |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Boletus satanas |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Xerocomus chrysenteron |
(none)
|
TATTAAAGTTGTTGCAGTTAAAAAGCTCGT |
Columns
None of the columns has a description.