@ARTICLE{TreeBASE2Ref24102,
author = {ohgew kweon and Seon-Jae Kim and Jochen Blom and Sung-Kwan Kim and Bong-Soo Kim and Dong-Heon Baek and Su Inn Park and John B. Sutherland and Carl E. Cerniglia},
title = {Comparative functional pan-genome analyses to build connections between genomic dynamics and phenotypic evolution in polycyclic aromatic hydrocarbon metabolism in the genus Mycobacterium},
year = {2015},
keywords = {Mycobacterium; PAH metabolism; Pan-genome; Functional genomics; Functional pan-genome; Phenotype Network; Evolution; epistasis; pleiotropy },
doi = {},
url = {http://},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: The genus Mycobacterium is of great interest for the medical and biotechnological fields. Despite a flood of genome sequencing and functional genomics data, there are still significant gaps in knowledge between genome and phenome, which seriously hinder efforts toward the treatment of mycobacterial diseases and practical biotechnological applications. In this study, we propose the use of systematic, comparative functional pan-genomic analysis to build connections between genomic dynamics and phenotypic evolution in polycyclic aromatic hydrocarbon (PAH) metabolism in the genus Mycobacterium.
Results: Phylogenetic, phenotypic, and genomic information for 27 completely genome-sequenced mycobacteria was systematically integrated to reconstruct a mycobacterial phenotype network (MPN) with a pan-genomic concept at a network level. In the MPN, mycobacterial phenotypes show typical scale-free relationships. PAH degradation is an isolated phenotype with the lowest connection degree, consistent with phylogenetic and environmental isolation of PAH degraders. A series of functional pan-genomic analyses provide conserved and unique types of genomic evidence for strong epistatic and pleiotropic impacts on evolutionary trajectories of the PAH-degrading phenotype. Under strong natural selection, the detailed gene gain/loss patterns by horizontal gene transfer (HGT)/deletion events hypothesize a plausible evolutionary path, an epistasis-based birth and pleiotropy-dependent death, for bacterial PAH metabolism in the genus Mycobacterium. This study generated a practical mycobacterial compendium of phenotypic and genomic changes, focusing on the PAH-degrading phenotype with a pan-genomic perspective of the evolutionary events and the environmental challenges.
Conclusions: Our findings suggest that when selection acts on PAH metabolism, only a small fraction of possible trajectories is likely to be observed, owing mainly to a combination of the ambiguous phenotypic effects of PAHs and the corresponding pleiotropy- and epistasis-dependent evolutionary adaptation. Evolutionary constraints on the selection of trajectories, like those seen in PAH-degrading phenotypes, are likely to apply to the evolution of other phenotypes in the genus Mycobacterium.
}
}
Matrix 25738 of Study 16971
Citation title:
"Comparative functional pan-genome analyses to build connections between genomic dynamics and phenotypic evolution in polycyclic aromatic hydrocarbon metabolism in the genus Mycobacterium".
Study name:
"Comparative functional pan-genome analyses to build connections between genomic dynamics and phenotypic evolution in polycyclic aromatic hydrocarbon metabolism in the genus Mycobacterium".
This study is part of submission 16971
(Status: Published).
Matrices
Title: Mycobacterium ML27myco
Description: 22 core genes of 27 mycobacteria
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Mycobacterium smegmatis MC2 155 |
(none)
|
------GTGGCGACGACGACGGCTGGGCTG |
Mycobacterium sp. MCS |
(none)
|
ATGGACGTGGTGCCGACGACGGCGGGTCAC |
Mycobacterium sp. KMS |
(none)
|
ATGGACGTGGTGCCGACGACGGCGGGTCAC |
Mycobacterium sp. JLS |
(none)
|
ATGGACGTGGTGCCGACGACGGCGGGTCAC |
Mycobacterium gilvum Spyr1 |
(none)
|
---ATGAACGTGGCGACAACGGCTGGTCTG |
Mycobacterium gilvum PYR-GCK |
(none)
|
---ATGAACGTGGCGACAACGGCTGGTCTG |
Mycobacterium vanbaalenii PYR-1 |
(none)
|
---ATGAACGTGCCGACAACGGCTGGTCTG |
Mycobacterium abscessus CIP 104536 |
(none)
|
ATGGATCTCGCGAGCCCCACTGCCGCAGAC |
Mycobacterium sp. JDM601 |
(none)
|
ATGGACGCGGCGACCACAAACGCGGGTCTG |
Mycobacterium avium 104 |
(none)
|
------------------------------ |
Mycobacterium avium paratuberculosis K-10 |
(none)
|
ATGGACGCGGCGACGACAACGGCTGGCCTC |
Mycobacterium ulcerans Agy99 |
(none)
|
ATGGACGCGGCTACGACACGAGCTGGTCTC |
Mycobacterium marinum M, ATCC BAA-535 |
(none)
|
ATGGACGCGGCTACGACACGAGCTGGTCTC |
Mycobacterium canettii CIPT 140010059 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium africanum GM041182 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium bovis AF2122/97 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium bovis BCG Tokyo 172 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium bovis BCG Pasteur 1173P2 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis KZN 1435 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis F11 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis H37Ra |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis H37Rv |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis CCDC5180 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis CCDC5079 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium tuberculosis CDC1551 |
(none)
|
ATGGACGCGGCTACGACAAGAGTTGGCCTC |
Mycobacterium leprae TN |
(none)
|
ATGGACCTGGCCAAAACCAATGTTGGTTGC |
Mycobacterium leprae Br4923 |
(none)
|
ATGGACCTGGCCAAAACCAATGTTGGTTGC |
Columns
None of the columns has a description.