@ARTICLE{TreeBASE2Ref17756,
author = {Susumu Takamatsu and Mihoko Inagaki and Seiko Niinomi and Seyed Akbar Khodaparast and H. D. Shin and Banga Grigaliunaite and Mar?a Havrylenko},
title = {Molecular phylogeny and evolution of the genus Phyllactinia (Ascomycete: Erysiphales) and its allied genera},
year = {2007},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycological Research},
volume = {},
number = {},
pages = {},
abstract = {Phyllactinia is a unique genus within the Erysiphales (Ascomycota) having a partly endo-parasitic nature of the mycelium within the host plant tissues. We constructed phylogenetic trees for the genus Phyllactinia and its allied genera based on a total of120 nucleotide sequences of the 28S rDNA and ITS regions to discuss their phylogenetic relationships with special references to host plants, biogeography, evolutionary dating, and taxonomy. The analysis of the Erysiphales confirmed the monophyly of the endo-parasitic genera, i.e., Leveillula, Phyllactinia and Pleochaeta. Phyllactinia specimens used in this study were divided into six distinctive groups and three subgroups. Interestingly, Leveillula, an obligately endo-parasitic genus of the Erysiphales, grouped together with Phyllactinia, although this was not significantly supported by the Kishino-Hasegawa and Shimodaira-Hasegawa tests. This suggests that the evolution within this group of fungi occurred from partial endo-parasitism to obligate endo-parasitism. The host range of Phyllactinia is mostly confined to woody plants, especially deciduous trees. Betulaceae, Fagaceae, Ulmaceae, Moraceae, and Rosaceae may have a close connection to the divergence of the groups and subgroups of Phyllactinia concerned. Most of these plant families are known as major members of the boreotropical flora of the Tertiary, which suggests an early Tertiary origin of this genus. A comparison of the phylogenies of hosts and parasites revealed that host range expansion at higher taxonomic levels (higher than family level) is independent of the phylogeny of plants. On the other hand, host range expansions in lower taxonomic levels (infrafamilial or infrageneric) tend to occur within a single family or genus. An estimation of the evolutionary timing using a molecular clock suggested that Phyllactinia split from Pleochaeta about 60 million years ago (Mya) in the early Tertiary and divergence of the six major clades of Phyllactinia occurred between 5 and 40 Mya during Oligocene and Miocene. Divergence within the major clades and within Leveillula occurred maybe more than 5 Mya in Pliocene and Quaternary. This is the first comprehensive phylogenetic study of Phyllactinia and other endo-parasitic genera of the Erysiphales.}
}
Matrix 2913 of Study 1919
Citation title:
"Molecular phylogeny and evolution of the genus Phyllactinia (Ascomycete: Erysiphales) and its allied genera".
This study was previously identified under the legacy study ID S1896
(Status: Published).
Matrices
Title: Fig. 5
Description: Legacy TreeBASE Matrix ID = M3481
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Phyllactinia fraxini ex Syringa vulgaris MUMH907 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia guttata ex Acer mandshuricum SMK17216 |
(none)
|
?????????????????????????????? |
Phyllactinia fraxini ex Fraxinus longicuspis MUMH426 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCCCGCG |
Phyllactinia fraxini ex Fraxinus longicuspis MUMH566 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus longicuspis MUMH212 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia guttata ex Wisteria sinensis MUMH908 |
(none)
|
?????????????????????????????? |
Phyllactinia sp. ex Chionanthus virgiuicus MUMH926 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus excelsior AF073350 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus sp. MUMH917 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus mandshurica SMK10643 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCCCGCG |
Phyllactinia fraxini ex Fraxinus excelsior MUMH915 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus excelsior MUMH914 |
(none)
|
CAGAGCGTGAAGACTTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus excelsior MUMH913 |
(none)
|
CAGAGCGTGAAGACTTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus excelsior MUMH912 |
(none)
|
CAGAGCGTGAAGACCTCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus excelsior MUMH911 |
(none)
|
CAGAGCGTGAAGAC?TCGGCCCCTCC-GCG |
Phyllactinia fraxini ex Fraxinus excelsior MUMH644 |
(none)
|
CAGAGCGTGAAGACTTCGGCCCCTCC-GCG |
Columns
None of the columns has a description.