@ARTICLE{TreeBASE2Ref24231,
author = {Inoka K Hettiarachchige and Piyumi N Ekanayake and Ross C Mann and Kathryn M Guthridge and Timothy I Sawbridge and German C Spangenberg and John W Forster},
title = {Phylogenomics of asexual Epichloe fungal endophytes forming associations with perennial ryegrass (Lolium perenne L.)},
year = {2015},
keywords = {pasture grass, whole genome sequencing, taxonomy, nuclear gene, mating type, progenitor},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {},
number = {},
pages = {},
abstract = {Background:
Perennial ryegrass (Lolium perenne L.) is one of the most important species for temperate pastoral agriculture, forming associations with genetically diverse groups of mutualistic fungal endophytes. However, only two taxonomic groups (Epichloe festucae var. lolii and LpTG-2) have so far been described. In addition to these two well-characterised species, a third distinct group of previously unclassified perennial ryegrass-associated endophytes was identified as belonging to a putative novel taxon (or taxa) (PNT) in a previous analysis based on simple sequence repeat (SSR) marker diversity. In addition to genotypic differences, distinctive alkaloid production profiles were observed for members of the PNT class.
Results:
A detailed phylogenetic analysis of perennial ryegrass-associated endophytes using components of whole genome sequence data was performed using complete sequences of 7 nuclear protein-encoding genes. Three independently selected genes (encoding a DEAD/DEAH box helicase [Sbp4], a glycosyl hydrolase [family 92 protein] and a MEAB protein), none of which have been previously used for biosystematic studies of endophytes, were selected together with the frequently used ?house-keeping? genes tefA and tubB (encoding translation elongation factor 1-a and β-tubulin, respectively). In addition, two classes of endophyte-specific gene (perA for peramine biosynthesis and MT for mating-type control) were included. The results supported previous phylogenomic inferences for the known species, but distinctive patterns of diversity for the previously unclassified endophyte strains, which were further proposed to belong not one but two distinct novel taxa. Potential progenitor genomes for the asexual endophytes among contemporary anamorphic (Epichlo?) species were also identified from the phylogenetic analysis.
Conclusions:
Unique taxonomic status for the PNT was confirmed through comparison of multiple nuclear gene sequences, and also supported by evidence from chemotypic diversity. Analysis of MT gene idiomorphs further supported a predicted independent origin of two distinct perennial ryegrass-associated novel taxa, designated LpTG-3 and LpTG-4, from different members of a similar founder population related to contemporary E. festucae. The analysis also provided higher resolution to the known progenitor contributions of previously characterised perennial ryegrass-associated endophyte taxa.
}
}
Matrix 30225 of Study 17154
Citation title:
"Phylogenomics of asexual Epichloe fungal endophytes forming associations with perennial ryegrass (Lolium perenne L.)".
Study name:
"Phylogenomics of asexual Epichloe fungal endophytes forming associations with perennial ryegrass (Lolium perenne L.)".
This study is part of submission 17154
(Status: Published).
Matrices
Title: Asexual Epichloe fungal endophytes Mating type gene sequences
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Epichloe festucae var lolii F02 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe typhina 9340 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 3 15310 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 3 15311 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii 15335 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii 15441 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii 15714 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii 15931 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii AR1 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii C09 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii E09 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAAA |
Epichloe festucae Fl1 HQ680590.1 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe typhina MAFF 306230 AB161000.1 |
(none)
|
------------------------------ |
Epichloe festucae var lolii NA6 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii NEA3 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 2 NEA4 GC1 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 2 NEA4 GC2 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii NEA2 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii NEA10 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 2 NEA11 GC1 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 3 NEA12 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Lolium perenne Taxonomic Group 2 NEA11 GC2 |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Epichloe festucae var lolii SE |
(none)
|
CTCGGTTCACTGTATTGATGTAGCAATAGA |
Columns
None of the columns has a description.