@ARTICLE{TreeBASE2Ref15070,
author = {Mihai Costea and Fiona Aiston and Sasa Stefanovic},
title = {Species delimitation, phylogenetic relationships and two new species in the Cuscuta gracillima complex (Convolvulaceae)},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Canadian Journal of Botany},
volume = {},
number = {},
pages = {},
abstract = {Basic morphology, scanning electron microscopy, and DNA sequence data from the plastid trnLF region and the nuclear internal transcriber (ITS) spacer regions were used to delimit the species of a recently circumscribed clade of Cuscutathe C. gracillima complex from Mexico, Central and northern South Americaand to investigate their phylogenetic relationships. The group is characterized by inflorescences that appear to emerge directly from the hosts stems. Eight lineages were recognized, with two of them proposed here as new species: C. punana from Ecuador and C. vandevenderi from Mexico. Cuscuta colombiana is redefined to include C. aristeguietae, and C. deltoidea is broadened to encompass C. serruloba. A taxonomic treatment with an identification key, descriptions, and illustrations is provided; the biogeography and conservation status of the eight species are also discussed.}
}
Matrix 3070 of Study 1996
Citation title:
"Species delimitation, phylogenetic relationships and two new species in the Cuscuta gracillima complex (Convolvulaceae)".
This study was previously identified under the legacy study ID S1981
(Status: Published).
Matrices
Title: C. gracilima: trnLF, ITS, indels
Description: Legacy TreeBASE Matrix ID = M3690
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Cuscuta warneri |
(none)
|
---------GACTTAATTGGATTGAGCCTT |
Cuscuta mcvaughii |
(none)
|
-------------------GATTGAGCCTT |
Cuscuta vandevenderi 1092 |
(none)
|
-----TACGGACTTAATTGGATTGAGCCTT |
Cuscuta vandevenderi 1079 |
(none)
|
-----TACGGACTTAATTGGATTGAGCCTT |
Cuscuta vandevenderi 1078 |
(none)
|
-----TACGGACTTAATTGGATTGAGCCTT |
Cuscuta vandevenderi 1058 |
(none)
|
GACGCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta deltoidea |
(none)
|
GACGCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta colombiana |
(none)
|
GACGCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta ariesteguietae |
(none)
|
GACGCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta sidarum 751 |
(none)
|
-------------------GATTGAGCCTT |
Cuscuta sidarum 519 |
(none)
|
-----TACGGACTTAATTGGATTGAGCCTT |
Cuscuta sidarum 1005 |
(none)
|
-------------------GATTGAGCCTT |
Cuscuta punana |
(none)
|
GACGCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta gracillima 621 |
(none)
|
---GCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta gracillima 600 |
(none)
|
-----TACGGACTTAATTGGATTGAGCCTT |
Cuscuta gracillima 599 |
(none)
|
-----TACGGACTTAATTGGATTGAGCCTT |
Cuscuta gracillima 620 |
(none)
|
GACGCTACGGACTTAATTGGATTGAGCCTT |
Cuscuta gracillima 463 |
(none)
|
------------TTAATTGGATTGAGCCTT |
Columns
None of the columns has a description.