@ARTICLE{TreeBASE2Ref16002,
author = {Jinhuo Jiang and Jianhua Li and Chengxin Fu and Mimi Li and Xiaodu Lou},
title = {Phylogenetics and biogeography of Wisteria (Fabaceae) inferred from sequences of chloroplast and nuclear DNA regions},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Previous molecular phylogenetic studies of Fabaceae indicated that species of Wisteria, an intercontinental disjunct genus between eastern Asia and eastern North America, form a clade derived from within Callerya. However, interspecific relationships were not well resolved or supported. In this study, we employed sequences of nrDNA ITS and chloroplast gene matK and intergenic spacer psbA-trnH to examine interspecific relationships and infer the character evolution and biogeographic history of Wisteria. Our results show that North American species of Wisteria form a sister relationship with the eastern Asian species. In the Asian clade, Wisteria brachybotrys of Japan is sister to the clade containing W. floribunda of Japan and Korea, and W. sinensis, W. villosa, and W. brevidentata of China. Sequences vary little among the three Chinese species and there is no well-supported phylogenetic structure, recognizing them as a single species. Our Fitch parsimony analysis suggests that Wisteria sinensis of the continental Asia may have derived from ancestral populations from Japan via Korean Peninsula. Both clockwise twining in W. floribunda and erose leaf margin in W. sinensis are more derived features within Wisteria.}
}
Matrix 3071 of Study 1997
Citation title:
"Phylogenetics and biogeography of Wisteria (Fabaceae) inferred from sequences of chloroplast and nuclear DNA regions".
This study was previously identified under the legacy study ID S1982
(Status: Published).
Matrices
Title: Wisteria: ITS, matK, psbA
Description: Legacy TreeBASE Matrix ID = M3691
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Wisteria villosa 5604 |
(none)
|
????????GGTGAACCTGCGGAAGGATCAT |
Wisteria villosa 5432 |
(none)
|
TTCCCGTAGGTGAACCTGCGGAAGGATCAT |
Wisteria villosa 4981 |
(none)
|
????????????????TGCGGAAGGATCAT |
Wisteria sinensis DAPA |
(none)
|
????????????????TGCGGAAGGATCAT |
Wisteria sinensis 5007 |
(none)
|
????CGTAGGTGAACCTGCGGAAGGATCAT |
Wisteria sinensis 4203 |
(none)
|
????????????AACCTGCGGAAGGATCAT |
Wisteria macrostachya |
(none)
|
???????AGGTGAACCTGCGGAAGGATCAT |
Wisteria fructescens 4206 |
(none)
|
TTCCCGTAGGTGAACCTGCGGAAGGATCAT |
Wisteria fructescens 4205 |
(none)
|
TTCCCGTAGGTGAACCTGCGGAAGGATCAT |
Wisteria floribunda 5601 |
(none)
|
??????????TGAACCTGCGGAAGGATCAT |
Wisteria floribunda 4208 |
(none)
|
TTCCCGTAGGTGAACCTGCGGAAGGATCAT |
Wisteria floribunda 4207 |
(none)
|
???????????GAACCTGCGGAAGGATCAT |
Wisteria brevidentata |
(none)
|
?????GTAGGTGAACCTGCGGAAGGATCAT |
Wisteria brachybotrys 5602 |
(none)
|
????????GGTGAACCTGCGGAAGGATCAT |
Wisteria brachybotrys |
(none)
|
?????????????????????????????T |
Callerya reticulata |
(none)
|
??????????????????????????TCAT |
Callerya megasperma |
(none)
|
??????????????????????????TCAT |
Callerya atropurpurea |
(none)
|
??????????????????????????TCAT |
Columns
None of the columns has a description.