@ARTICLE{TreeBASE2Ref23695,
author = {Natalia Fraija-Fernandez and Peter Olson and Enrique Crespo and Juan Antonio Raga and Francisco Javier Aznar and Mercedes Fernandez},
title = {Independence host switching events by digeneans parasites of cetaceans inferred from ribosomal DNA.},
year = {2015},
keywords = {Digenea, cetacea, molecular phylogeny, host switching},
doi = {10.1016/j.ijpara.2014.10.004},
url = {http://},
pmid = {},
journal = {International Journal for Parasitology},
volume = {45},
number = {2-3},
pages = {167--173},
abstract = {Cetaceans harbour a unique fauna of digenean parasites (Platyhelminthes) that has been acquired either from multiple, independent host capture events or through diversification following the original colonisation of cetaceans. Disparity in the species reported indicates that they do not share close affinities, but their unusual morphology has made their taxonomic identities and phylogenetic positions uncertain. Here we use sequence data to investigate the phylogenetic relationships of the main species of fluke infecting cetaceans. We sequenced the 18S, 28S and ITS2 rDNA of digenean species representing all known families reported from cetaceans: Braunina cordiformis (Brauninidae), Ogmogaster antarcticus (Notocotylidae), Pholeter gastrophilus (Heterophyidae), and Campula oblonga, Nasitrema sp. and Oschmarinella rochebruni (Brachycladiidae). The phylogenetic positions of the taxa were estimated by Bayesian inference and Maximum Likelihood in the context of overall digenean diversity, incorporating published sequences of over 170 species. Species nominally assigned to the Brachycladiidae formed a clade that was embedded among species of the Acanthocolpidae, thus making the latter family paraphyletic. Braunina cordiformis formed a sister lineage to the Strigeidae and Diplostomidae, whereas Ogmogaster antarcticus was placed within the Notocotylidae, in agreement with the previous taxonomy of this genus. Similarly, Pholeter gastrophilus was placed within the Heterophyidae as originally described. Our results suggest a paraphyletic relationship between the Heterophyidae and Opisthorchiidae, mirroring the uncertain taxonomic placement of P. gastrophilus, which has been assigned to both families in the past. All digenean families involved are parasites of fish-eating birds, with the exception of the Acanthocolpidae, which are parasites of marine fish, and species of the Notocotylidae, which are parasites of birds and mammals with aquatic affinities. The phylogenetic positions of these taxa show that the digenean fauna of cetaceans has been acquired predominately through independent host-capture events, whereas two clades shows diversification exclusively among marine mammals.}
}
Matrix 32347 of Study 16416
Citation title:
"Independence host switching events by digeneans parasites of cetaceans inferred from ribosomal DNA.".
Study name:
"Independence host switching events by digeneans parasites of cetaceans inferred from ribosomal DNA.".
This study is part of submission 16416
(Status: Published).
Matrices
Title: Brachycladiidae NAD3
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Echinostoma revolutum |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Clonorchis sinensis |
(none)
|
------------------------------ |
Haplorchis taichui |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Haplorchis pumilio |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Haplorchis yokogawai |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Procerovum varium |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Metagonimus yokogawai |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Metagonimus takahashii |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Pygidiopsis genata |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Ascocotyle longa |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Procerovum cheni |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Euryhelmis costaricensis |
(none)
|
GCGAATGGCTCATTAAATCAGCTATGGTTC |
Opisthorchis viverrini |
(none)
|
------------------------------ |
Pholeter gastrophilus |
(none)
|
------------------------------ |
Columns
None of the columns has a description.