@ARTICLE{TreeBASE2Ref17082,
author = {Yohan Pillon and H. C. F. Hopkins and J?r?me Munzinger and Mark W. Chase},
title = {A molecular and morphological survey of generic limits of Acsmithia and Spiraeanthemum (Cunoniaceae)},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {A phylogenetic analysis was conducted on the tribe Spiraeanthemeae (Cunoniaceae) to clarify relationships of the genera Acsmithia and Spiraeanthemum. Three molecular markers, one plastid region (trnL intron and trnL-trnF intergenic spacer) and two nuclear-single copy genes (ncpGS and PHYC), were sequenced for this purpose. The independent analysis of the three markers and a combined analysis all showed that the genus Acsmithia is paraphyletic with the genus Spiraeanthemum nested within it. A morphological survey of all species in the tribe confirmed the existence of two groups within Acsmithia. One comprises the species from Australia, New Guinea, and A. densiflora from New Caledonia and is characterised by multiple ovules per carpel. The other group contains all remaining New Caledonian species plus A. vitiensis from Fiji and is characterised by a single ovule per carpel. The study shows that characters previously used to distinguish Acsmithia and Spiraenthemum, phyllotaxy and sexual system, are homoplasious as in several other groups of Cunoniaceae. A broad circumscription of the genus Spiraeanthemum is adopted here that includes the species formerly placed in Acsmithia. Two new combinations are proposed: Spiraeanthemum collinum and Spiraeanthemum meridionale. Spiraeanthemum austrocaledonicum is considered a synonym of Spiraeanthemum densiflorum.}
}
Matrix 3318 of Study 2115
Citation title:
"A molecular and morphological survey of generic limits of Acsmithia and Spiraeanthemum (Cunoniaceae)".
This study was previously identified under the legacy study ID S2119
(Status: Published).
Matrices
Title: trnL
Description: Legacy TreeBASE Matrix ID = M4007
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Brunellia colombiana |
(none)
|
CTTTCAAATTCAGAGAAACCCTGGAATTAA |
Platylophus trifoliatus |
(none)
|
CTTTCAAATTCAGAGAAACCCTGGAATTAA |
Hooglandia ignambensis |
(none)
|
CTTTCAAATTCAGAGAAACCCTGGAATTAA |
Spiraeanthemum brongniartianum |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum ellipticum |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum meridionale |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum pubescens |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum densiflorum YP667 |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum densiflorum JM4575 |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum macgillivrayi |
(none)
|
CTTTCAA-TTCAGAGAAACCCTGGAATGAA |
Spiraeanthemum samoense |
(none)
|
CTTTCAAATTCAGAGAAACCCTGGAATGAA |
Columns
None of the columns has a description.