@ARTICLE{TreeBASE2Ref2187,
author = {Peter B. Heenan and Simon Joly and Peter J. Lockhart},
title = {A Pleistocene inter-tribal allopolyploidization event precedes the species radiation of Pachycladon (Brassicaceae) in New Zealand.},
year = {2009},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {The Southern Alps in New Zealand contain many herbaceous plant groups that have radiated during the Plicoene-Pleistocene. The species in these genera tend to be polyploid relative to their overseas close relatives, an observation of much interest given that hybridization and allopolyploidy have recently been suggested as a possible stimulus for adaptive radiation. We were interested to determine whether or not allopollyploidy was a feature of Pachycladon, a genus which is hypothesised to have adaptively diversified onto different geological substrates in the mountains of the South Island of New Zealand. Phylogenetic analyses of five single-copy nuclear genes show that Pachycladon species have two copies of each gene representing two highly diverged evolutionary lineages from the Brassicaceae. Molecular clock analyses of all loci suggest that the two genome copies in Pachycladon diverged 8 million years ago, and that the allopolyploid origin of the genus occurred during the Pleistocene between 1.6 and 0.8 million years ago. Thus, the hybridization event at the origin of the Pachycladon radiation is perhaps the most extreme example yet reported of successful hybridization between distantly related parents.}
}
Matrix 3400 of Study 2250
Citation title:
"A Pleistocene inter-tribal allopolyploidization event precedes the species radiation of Pachycladon (Brassicaceae) in New Zealand.".
This study was previously identified under the legacy study ID S2261
(Status: Published).
Matrices
Title: PRK
Description: Legacy TreeBASE Matrix ID = M4292
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Arabidopsis thaliana |
(none)
|
CAAAGCTCTTAAGAATGGTATAGCCGTCGA |
Arabidopsis lyrata lyrata clone2 |
(none)
|
CAAAGCTCTTAAGAGTGGTGTTGCCGTTGA |
Olimarabidopsis cabulica clone1 |
(none)
|
CAAGGCTCTTAAGAGTGGTGTCGCCGTTGA |
Capsella bursapastoris clone2 |
(none)
|
CAAGGCTCTCAAGAATGGTATCGCCGTCGA |
Capsella bursapastoris clone4 |
(none)
|
CAAGGCTCTCAAGAATGGTATCGCCGTCGA |
Transberingia bursifolia bursifolia clone1 |
(none)
|
--------TTAAGAGTGGTGTCGCCGTCGA |
Crucihimalaya mollissima clone5 |
(none)
|
CAAAGCTCTTAAGAGTGGTGTCGCCGTCGA |
Crucihimalaya mollissima clone2 |
(none)
|
CAAAGCTCTTAAGAGTGGTGTCGCCGTCGA |
Pachycladon fastigiata A |
(none)
|
------------------------------ |
Pachycladon cheesemanii 6 1 A |
(none)
|
------------------------------ |
Pachycladon exilis A |
(none)
|
------------------------------ |
Boechera holboellii clone3 |
(none)
|
CAAAGCTCTTAAGAGTGGTGTCGCCGTCCA |
Pachycladon cheesemanii B |
(none)
|
------------------------------ |
Pachycladon exilis B |
(none)
|
------------------------------ |
Pachycladon fastigiata B |
(none)
|
------------------------------ |
Lepidium apelatum clone3 |
(none)
|
CAAGGCTCTTAAGAGTGGTGTCGCCGTCGA |
Lepidium apelatum clone5 |
(none)
|
CAAGGCTCTTAAGAGTGGTGTCGCCGTCGA |
Thellungiella spp clone4 |
(none)
|
CAAAGCTCTCAAGAGTGGTGTCGCCGTCGA |
Physaria fendleri clone1 |
(none)
|
CAAGGCTCTTAAGAACGGTGTTGCTGTCGA |
Physaria fendleri clone3 |
(none)
|
TAAGGCTCTTAAGAATGGTGTCGCTGTTGA |
Physaria fendleri clone4 |
(none)
|
CAAGGCTCTTAAGAACGGTGTTGCTGTTGA |
Columns
None of the columns has a description.