@ARTICLE{TreeBASE2Ref16624,
author = {Michael R. McGowen and Clay Clark and John Gatesy},
title = {The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.},
year = {2008},
keywords = {},
doi = {10.1080/10635150802304787},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {57},
number = {4},
pages = {574--590},
abstract = {The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully-resolved, consistently-supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (>5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.}
}
Matrix 3443 of Study 2138
Citation title:
"The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.".
This study was previously identified under the legacy study ID S2142
(Status: Published).
Matrices
Title: Part B- nrDNA
Description: Legacy TreeBASE Matrix ID = M4063
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Bos taurus |
(none)
|
CCCAGGCTTGGAGGGATGCCCCAC-AACCC |
Eubalaena japonica |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCCCAATCC |
Physeter macrocephalus |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AATCC |
Phocoena phocoena |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AGTCC |
Orcinus orca |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AATCC |
Pseudorca crassidens |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AATCC |
Steno bredanensis |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AATCC |
Delphinus delphis |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AATCC |
Stenella coeruleoalba |
(none)
|
CCCGGCCTTGGAGGGATGCCCCCC-AATCC |
Columns
None of the columns has a description.