@ARTICLE{TreeBASE2Ref25526,
author = {Masahiro Suzuki and Takahiro Segawa and Hiroshi Mori and Ayumi Akiyoshi and Ryo Ootsuki and Akira Kurihara and Taiju Kitayama and Tsuyoshi Abe and Kazuhiro Kogame and Hisayoshi Nozaki},
title = {Next-generation sequencing of an 88-year-old specimen of the poorly known species Liagora japonica (Nemaliales, Rhodophyta) supports the recognition of Otohimella gen. nov.},
year = {2016},
keywords = {extinct species; florideophycean red algae; next-generation sequencing; new genus; old specimen; phylogenetic analysis; seaweed; taxonomy},
doi = {},
url = {http://},
pmid = {},
journal = {PLOS One},
volume = {},
number = {},
pages = {},
abstract = {Liagora japonica is a red algal species distributed in temperate regions of Japan. The species has not been collected from its type locality on the Pacific coast of Japan since 1927, and seems to have become extinct from the vicinity. To molecularly characterize L. japonica, we extracted DNA from topotype material of L. japonica collected in 1927, analyzed nine genes using Illumina next-generation sequencing, and compared these data with sequences from modern samples of similar red algae collected from the Japan Sea coast of Japan. Both morphological and molecular data from modern samples and historical specimens (including the lectotype and topotype) suggest that the specimens from the Pacific and Japan Sea coasts of Japan should be treated as a single species, and that L. japonica is phylogenetically separated from the genus Liagora. Based on the phylogenetic results and an examination of reproductive structures, we propose Otohimella japonica gen. et comb. nov., characterized morphologically by diffuse carposporophytes, undivided carposporangia, and the involucral filaments initiated only from the subcortical cell on the supporting cell.}
}
Matrix 35111 of Study 18829
Citation title:
"Next-generation sequencing of an 88-year-old specimen of the poorly known species Liagora japonica (Nemaliales, Rhodophyta) supports the recognition of Otohimella gen. nov.".
Study name:
"Next-generation sequencing of an 88-year-old specimen of the poorly known species Liagora japonica (Nemaliales, Rhodophyta) supports the recognition of Otohimella gen. nov.".
This study is part of submission 18829
(Status: Published).
Matrices
Title: Liagora japonica psaB
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Liagora japonica OJ1 |
(none)
|
ATGGCAACAAAATTCCCTAAATTTAGCCAA |
Calliarthron tuberculosum KC153978 psaB |
(none)
|
ATGGCAACCAAATTTCCAAAGTTTAGCCAA |
Chondrus crispus HF562234 psaB |
(none)
|
ATGGGAACAAAATTTCCGAAGTTTAGCCAA |
Gracilaria salicornia KF861575 |
(none)
|
ATGGCAACAAAATTTCCAAAATTTAGCCAA |
Grateloupia taiwanensis KC894740 psaB |
(none)
|
ATGGCAACAAAATTTCCAAAATTTAGCCAA |
Pyropia haitanensis KC464603 psaB |
(none)
|
ATGGCAACAAAATTTCCTAAGTTTAGCCAA |
Pyropia yezoensis KC517072 |
(none)
|
ATGGCAACAAAATTTCCTAAGTTTAGCCAA |
Porphyridium purpureum AP012987 |
(none)
|
ATGGCAACAAAATTCCCTAAATTTAGCCAG |
Columns
None of the columns has a description.