@ARTICLE{TreeBASE2Ref26896,
author = {Nicole K. Reynolds and Matthew E. Smith and Eric Dennis Tretter and Justin Gause and Dustin Heeney and Mat?as Jorge Cafaro and James F. Smith and Steven J. Novak and William A. Bourland and Merlin M. White},
title = {Resolving relationships at the animal-fungal divergence: A molecular phylogenetic study of the protist trichomycetes (Ichthyosporea, Eccrinida)},
year = {2017},
keywords = {Eccrinida, evolution, Ichthyosporea, protists, symbiosis, trichomycetes},
doi = {10.1016/j.ympev.2017.02.007},
url = {http://},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {109},
number = {},
pages = {447--464},
abstract = {Trichomycetes is a group of microorganisms that was considered a class of fungi comprising four orders of commensal, gut-dwelling endosymbionts obligately associated with arthropods. Since molecular phylogenies revealed two of those orders (Amoebidiales and Eccrinales = ?protist trichos?) to be closely related to members of the protist class Ichthyosporea (= Mesomycetozoea), trichomycetes have been considered an ecological association of both early-diverging fungi and protists. Understanding of the taxonomy, evolution, and diversity of the protist trichos is lacking largely due to the difficulties inherent in species collection that have contributed to undersampling and understudy. The most recent classification divides the protist trichos between two families, Amoebidiidae and Eccrinidae (suborder Trichomycina, order Eccrinida). However, there is no comprehensive molecular phylogeny available for this group and major questions about the systematics of protist trichos remain unanswered. Therefore, we generated 18S and 28S rDNA sequences for 106 protist tricho samples and combined them with publicly available Eccrinida sequences for phylogenetic analyses. We also sequenced a conserved protein-coding gene (heat-shock 70 protein) to obtain a multigene data set. We conducted ancestral state reconstruction (ASR) and Bayesian tip-association significance test (BaTS) analyses by mapping six morphological and ecological characters onto the resulting phylogenetic trees. Our results demonstrate: 1) several ecological and morphological character states (habitat, host type, host stage at time of infestation, location within host, spore production, and growth form) are significantly correlated with the phylogeny, and 2) two additional protist tricho families should be incorporated into the taxonomy to reflect phylogenetic relationships. Our data suggest that an integrated strategy that combines morphological, ecological, and molecular characters is needed to further resolve and clarify the systematics of the Eccrinida.}
}
Matrix 40121 of Study 20595
Citation title:
"Resolving relationships at the animal-fungal divergence: A molecular phylogenetic study of the protist trichomycetes (Ichthyosporea, Eccrinida)".
Study name:
"Resolving relationships at the animal-fungal divergence: A molecular phylogenetic study of the protist trichomycetes (Ichthyosporea, Eccrinida)".
This study is part of submission 20595
(Status: Published).
Matrices
Title: Trichomycetes 3-genes
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Amoebidium parasiticum A1a_377 |
(none)
|
????????????????????????????AC |
Amoebidium parasiticum FRA_1_14_209 |
(none)
|
?????????GGCGCCATTGCCGGCCTTAAC |
Amoebidium parasiticum NRRL20524 |
(none)
|
?????????GGGGCCATCTCCGGGCTCAAC |
Capsaspora owczarzaki ATCC_30864_Gastropoda |
(none)
|
AAGGATGCCGGCACCATCTCTGGCATGAAC |
Corallochytrium limacisporum Opisthokonta |
(none)
|
AAGGATGCCGGTACCATTGCGGGATTGAAG |
Creolimax fragrantissima CH2_Sipunculida_1240 |
(none)
|
?????????GGTGCTATCTGCGGCATGAAC |
Enterobryus sp FL 2 W7 Diplopoda 872 |
(none)
|
?????????GGGACCATTTCTGGCATGAAT |
Enterobryus sp SPA 10 C6 Diplopoda 1137 |
(none)
|
?????????GGCACCATCTCTGGCATGAAT |
Ichthyophonus sp ID 155 N2 1 Actinopterygii 1194 |
(none)
|
?????????????????????????????? |
Ministeria vibrans ATCC_50519_Filasterea |
(none)
|
AAGGACGCCGGTGTCATTGCCGGTCTCAAC |
Nuclearia simplex CCAP1552_4_Nucleariida |
(none)
|
AAGGATGCCGGAGTCATTTGTGGTTTGAAC |
Palavascia patagonica ARG_D1_C15_1154 |
(none)
|
?????????GGCACTATTTCTGGTATGAAC |
Paramoebidium corpulentum KS114_3_Capniidae_1214 |
(none)
|
?????????????????????????????? |
Paramoebidium sp AR 30 C7 Siphlonuridae 618 |
(none)
|
?????????????????????????????? |
Paramoebidium sp AR 31 C7 1176 |
(none)
|
?????????GGTACCATCTCTGGTATGAAC |
Paramoebidium sp NOR 16 W3 Nemouridae 551 |
(none)
|
?????????GGGACGATCTCGGGGCTCAAT |
Paramoebidium sp NOR 3 W2 Amphinemouridae 526 |
(none)
|
?????????GGAACCATCTCCGGGCTTAAC |
Paramoebidium sp NOR 50 W2 Taeniopterygidae 680 |
(none)
|
?????????????????????????????? |
Paramoebidium sp NOR 5 2 Nemouridae 538 |
(none)
|
?????????GGGACGATCTCAGGGCTCAAT |
Paramoebidium sp NOR 7 W2 Amphinemouridae 533 |
(none)
|
?????????GGAACCATCTCCGGGCTTAAC |
Paramoebidium sp NS 35 W22b Ephemeroptera 511 |
(none)
|
?????????GGTACCATATCTGGTATGAAT |
Paramoebidium sp NS 6 W8 10 41 |
(none)
|
?????????GGTACCATCTCTGGTATGAAC |
Paramoebidium sp NS X 17 Amphinemouridae 830 |
(none)
|
?????????????????????????????? |
Paramoebidium sp OR 14 W1 1225 |
(none)
|
?????????GGTACCATCTCCGGGATGAAC |
Sphaeroforma arctica 1242 |
(none)
|
?????????GGTGCTATCTGCGGCATGAAC |
Sphaeroforma arctica GB_Amphipoda |
(none)
|
?????????GGTGCTATCTGCGGCATGAAC |
Sphaeroforma sp ATCC PRA 283 1239 |
(none)
|
?????????GGTGCCATCTGCGGCATGAAC |
Columns
None of the columns has a description.