@ARTICLE{TreeBASE2Ref18537,
author = {Molly R. Letsch and Gis?le Muller-Parker and Thomas Friedl and Louise A. Lewis},
title = {Elliptochloris marina n. sp. (Trebouxiophyceae, Chlorophyta), Symbiotic Green Alga of the Temperate Pacific Sea Anemones Anthopleura xanthogrammica and A. elegantissima (Anthozoa, Cnidaria)},
year = {2009},
keywords = {},
doi = {10.1111/j.1529-8817.2009.00727.x},
url = {},
pmid = {},
journal = {Journal of Phycology},
volume = {45},
number = {5},
pages = {1127--1135},
abstract = {Symbiotic green algae from two species of Pacific sea anemones, Anthopleura elegantissima Brandt, and Anthopleura xanthogrammica Brandt, were collected across their known range from the northeastern Pacific coast of North America. Freshly isolated Anthopleura symbionts were used for both morphological and molecular techniques because Anthopleura symbiont cultures were not available. Light and transmission electron microscopy supported previous morphological studies, showing the symbionts consist of spherical unicells from 5-10 ?m in diameter, with numerous vesicles, and a single bilobed chloroplast. Pyrenoids were not observed in light microscopy but a thylakoid free area was observed in transmission electron microscopy, consistent with previous findings. Many cells extracted from fresh anemone tissue were observed in the process of division, producing two autospores within a maternal cell wall. The morphology of the green symbionts matches that of Elliptochloris Tschermak-Woess. Molecular phylogenetic analyses of data from the nuclear SSU rDNA, and the plastid encoded gene for the large subunit of RUBISCO (rbcL) support the monophyly of these green algal symbionts, regardless of their host species or geographic origin. Phylogenetically, sequences of the Anthopleura symbionts were nested within the genus Elliptochloris but distinct from sequences of all other Elliptochloris spp. examined. Given the ecological and phylogenetic distinctions among the green symbionts taken from Anthopleura and the named species of Elliptochloris, we designate the green anemone symbionts as a new species, Elliptochloris marina (Trebouxiophyceae, Chlorophyta).}
}
Matrix 4167 of Study 10046
Citation title:
"Elliptochloris marina n. sp. (Trebouxiophyceae, Chlorophyta), Symbiotic Green Alga of the Temperate Pacific Sea Anemones Anthopleura xanthogrammica and A. elegantissima (Anthozoa, Cnidaria)".
This study was previously identified under the legacy study ID S2386
(Status: Published).
Matrices
Title: Combined SSU and rbcL
Description: Legacy TreeBASE Matrix ID = M4527
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Zoochlorellae 101 Combined |
(none)
|
---------------------------GCC |
Zoochlorellae 102 Combined |
(none)
|
-----------------------------C |
Zoochlorellae 141 Combined |
(none)
|
------------------------------ |
Zoochlorellae 104 Combined |
(none)
|
----TCATATGCTTGTCTCAAAGATTAGGC |
Zoochlorellae AY577786 AY577787 |
(none)
|
------------------------------ |
Zoochlorellae 103 Combined |
(none)
|
---------------------------GCC |
Zoochlorellae 114 Combined |
(none)
|
------------------------------ |
Elliptochloris bilobata SAG245.80 |
(none)
|
-TAGTCATATGCTTGTCTCAAAGATTAAGC |
Elliptochloris sp. SAG2117 |
(none)
|
GTAGTCATATGCTTGTCTCAAAGATTAAGC |
Elliptochloris sp. SAG2201 |
(none)
|
GTAGTCATATGCTTGTCTCAAAGATTAAGC |
Elliptochloris sp. SAG2202 |
(none)
|
GTAGTCATATGCTTGTCTCAAAGATTAAGC |
Coccomyxa chodatii SAG216.2 UTEX266 |
(none)
|
----TCATATGCTTGTCTCAAAGATTAAGC |
Columns
None of the columns has a description.