@ARTICLE{TreeBASE2Ref27311,
author = {Emily M Walsh and Weijun Duan and Maryem Mehdi and Kamal Naphri and Ning Zhang},
title = {Two new Cadophora species associated with the roots of sedge and spruce in a Western Canada subalpine forest},
year = {2017},
keywords = {Cadophora; Dark septate endophytes; Fungi; Leotiomycetes; Phylogeny; Taxonomy },
doi = {},
url = {http://},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {Two new species of Cadophora are described based on multi-gene phylogenetic analyses, phenotypic and ecological characters. The species delimitation was based on concordance of multiple gene genealogies. The cultures of the Cadophora species were isolated from the roots of long-beak sedge and white spruce from a subalpine forest in Western Canada; however, they likely have a wide distribution because their internal transcribed spacer (ITS) sequences have high similarity with a number of GenBank sequences from various ecological studies. The taxonomy of Cadophora in Leotiomycetes is discussed based on the phylogeny generated in this study. Results from this work will facilitate ecological and evolutionary studies on root-associated fungi. }
}
Matrix 42989 of Study 21150
Citation title:
"Two new Cadophora species associated with the roots of sedge and spruce in a Western Canada subalpine forest".
Study name:
"Two new Cadophora species associated with the roots of sedge and spruce in a Western Canada subalpine forest".
This study is part of submission 21150
(Status: Published).
Matrices
Title: Cadophora 5 gene
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Acidomelania panicicola |
(none)
|
------------------------------ |
Acephala applanata |
(none)
|
------------------------------ |
Barrenia panicia |
(none)
|
------------------------------ |
Barrenia taeda |
(none)
|
------------------------------ |
Cadophora gregata |
(none)
|
------------------------------ |
Cadophora luteo olivacea |
(none)
|
------------------------------ |
Cadophora malorum |
(none)
|
------------------------------ |
Cadophora orchidicola |
(none)
|
------------------------------ |
Cadophora orientoamericana |
(none)
|
------------------------------ |
Cadophora interclivum BAG4 |
(none)
|
-AGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Cadophora interclivum BAP33 |
(none)
|
TAGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Cadophora interclivum BAP37 |
(none)
|
--GAGGAAGTAAAAGTCGTAACAAGGTTTC |
Cadophora meredithiae BAG2 |
(none)
|
TAGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Cadophora meredithiae BAP6 |
(none)
|
-AGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Cadophora meredithiae BAP13 |
(none)
|
-AGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Cudoniella clavus |
(none)
|
---------AAAAAGTCGTAACAAGGTTTC |
Dermea acerina |
(none)
|
------------------------------ |
Lambertella subrenispora |
(none)
|
-------------------AACAAGGTTTC |
Mollisia cinerea |
(none)
|
------------------------------ |
Neobulgaria pura |
(none)
|
------------------------------ |
Columns
None of the columns has a description.