Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 4584 of Study 10046
Citation title: "Elliptochloris marina n. sp. (Trebouxiophyceae, Chlorophyta), Symbiotic Green Alga of the Temperate Pacific Sea Anemones Anthopleura xanthogrammica and A. elegantissima (Anthozoa, Cnidaria)".
This study was previously identified under the legacy study ID S2386
(Status: Published).
Matrices
Title: rbcL DNA
Description: Legacy TreeBASE Matrix ID = M4526
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Volvox carteri D63446 | (none) | ------------------------------ |
| Chlorella vulgaris AB001684 | (none) | ATGTCTCCACAAACTGAAACTAAAGCAAGG |
| Chlorella ellipsoidea D10997 | (none) | ATGTCTCCACAAACTGAAACTAAAGCAAGG |
| Prasiola meridionalis AF189066 | (none) | ------------------------------ |
| Trebouxia anticipata AF189069 | (none) | ------------------------------ |
| Myrmecia biatorellae AF499685 | (none) | --------------------------AAGT |
| Pleurastrum erumpens AF189068 | (none) | ------------------------------ |
| Leptosira terrestris AM260448 | (none) | ------------------------------ |
| Prasiolopsis ramosa EF203015 | (none) | ------------------------------ |
| Trichophilus welckeri EF203012 | (none) | ------------------------------ |
| Fusochloris perforata EF113438 | (none) | ------------------------------ |
| Oocystis apiculata EF113459 | (none) | -------------------------CAGGT |
| Coccomyxa chodatii UTEX266 | (none) | ------------------------------ |
| Coccomyxa rayssiae UTEX273 | (none) | ------------------------------ |
| Gloeotila contorta EF113444 | (none) | ------------------------------ |
| Chlorella saccharophila AM260446 | (none) | ------------------------------ |
| Chlorella sorokiniana EF113429 | (none) | ----------------------------GT |
| Closteriopsis EF113433 | (none) | -----------------------AGCAGGT |
| Myrmecia israelensis EF113453 | (none) | ------------------------------ |
| Trebouxia arboricola AM158960 | (none) | ------------------------------ |
| Choricystis minor DQ219818 | (none) | ------------------------------ |
| Choricystis AY902225 | (none) | ------------------------------ |
| Zoochlorellae 101 102 104 106 107 141 113 AY577787 | (none) | -------------------------TGGTG |
| Zoochlorellae 103 105 109 | (none) | -------------------------TGGTG |
| Zoochlorellae 114 | (none) | ------------------------------ |
| Elliptochloris SAG 245.8 | (none) | ------------------------------ |
| Elliptochloris SAG 2117 | (none) | ------------------------------ |
| Elliptochloris SAG 2201 | (none) | ------------------------------ |
| Elliptochloris SAG 2202 | (none) | ------------------------------ |
Columns
None of the columns has a description.
