@ARTICLE{TreeBASE2Ref18779,
author = {Sally Harrow and Reza Farrokhi-Nejad and Andrew Pitman and Ian Scott and Alison Bentley and Charlotte Hide and Matthew Cromey},
title = {Characterisation of New Zealand Fusarium populations using a polyphasic approach differentiates the F. avenaceum/F. acuminatum/F. tricinctum species complex in cereal and grassland systems.},
year = {2010},
keywords = {Biogeography; Cereals; Fusarium; Grasses; Molecular phylogeny},
doi = {10.1016/j.funbio.2010.01.005},
url = {},
pmid = {},
journal = {Fungal Biology},
volume = {114},
number = {4},
pages = {293--311},
abstract = {The purpose of this study was to determine the diversity and prevalence of Fusarium species in a survey of cereal and grassland systems from the South Island of New Zealand by applying morphological and molecular techniques. Isolates were collected from soil, roots and stems from 21 cereal and grassland sites. Ten Fusarium species were identified using morphological characters, including F. acuminatum, F. avenaceum, F. crookwellense, F. culmorum, F. equiseti, F. oxysporum, F. poae, F. pseudograminearum, F. sambucinum and F. tricinctum. In general, their distribution was found to be unrelated to biogeographical location, although agricultural practice increased the overall diversity of Fusarium. Phylogenetic analyses were successfully used to identify morphologically similar isolates belonging to the F. avenaceum/F. acuminatum/F. tricinctum species complex and to resolve previously undetermined relationships amongst these species. Fifty-eight isolates classified as either F. avenaceum, F. acuminatum or other closely related species as well as several well characterised isolates from international culture collections were examined using DNA sequence data from the ?-tubulin (?TUB), translation elongation factor 1? (EF1?) and mitochondrial small subunit ribosomal RNA (mtSSU) genes. Analyses of gene sequence data from both ?TUB and EF1? discriminated among isolates of F. avenaceum, F. acuminatum and F. tricinctum and determined that these three distinct sequence groups formed a single clade. By contrast, mtSSU was unable to differentiate F. avenaceum from F. acuminatum and other closely related species believed to be F. tricinctum. Comparison of the EF1? sequences with the international FUSARIUM-ID database supported the identification of isolates in this study. As in other studies, F. avenaceum was found to be widespread in agricultural and native ecosystems. However, F. acuminatum in New Zealand was found only on non-wheat hosts. The reason for the absence of this wheat pathogen in cereal-based ecosystems in New Zealand remains unknown. }
}
Matrix 4907 of Study 10289
Citation title:
"Characterisation of New Zealand Fusarium populations using a polyphasic approach differentiates the F. avenaceum/F. acuminatum/F. tricinctum species complex in cereal and grassland systems.".
This study was previously identified under the legacy study ID S2649
(Status: Published).
Matrices
Title: Elongation factor 1-alpha DNA
Description: Legacy TreeBASE Matrix ID = M5089
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Fusarium acuminatum EF1a 8 |
(none)
|
GCACTCGGA-ACCTGCCAA-ACCTGGCGGG |
Fusarium acuminatum EF1a 9 |
(none)
|
GCACTCGGA-ACCTGCCAA-ACCTGGCGGG |
Fusarium avenaceum EF1a 1 |
(none)
|
GCACTCGGA-ACCCGCCGA-ACCTGGCGGG |
Fusarium avenaceum EF1a 2 |
(none)
|
GCACTCGGA-ACCCGCCGA-ACCTGGCGGG |
Fusarium avenaceum EF1a 3 |
(none)
|
GTACTCGGA-ACCCGCCAA-ACCTGGCGGG |
Fusarium avenaceum EF1a 5 |
(none)
|
GCACTCGGA-ACCCGCCAA-ACCTGGCGGG |
Fusarium avenaceum EF1a 4 |
(none)
|
GCACTCGGA-ACCCGCCAA-ACCTGGCGGG |
Fusarium avenaceum EF1a 6 |
(none)
|
GCACTCGGA-ACCCGT-AA-ACCTAGCGGG |
Fusarium avenaceum EF1a 7 |
(none)
|
GCACTCGGA-ACCCGCC-A-GCTTGGCGGG |
Fusarium tricinctum EF1a 13 |
(none)
|
GCACTCGGA-ACCCGCCAA-ACCTGGCGGG |
Fusarium tricinctum EF1a 12 |
(none)
|
GCACTCGGA-ATCCGCCAA-ACCTGGCGGG |
Fusarium tricinctum EF1a 14 |
(none)
|
GCACTCGGA-ATCCGCCAA-ACCTGGCGGG |
Fusarium tricinctum EF1a 10 |
(none)
|
GCACTCGGA-ACCCGCCCA-ACCTGGCGGG |
Fusarium tricinctum EF1a 11 |
(none)
|
GCACTCGGA-ACCCGCCCA-ACCTGGCGGG |
Fusarium cerealis EF1a 18 |
(none)
|
GCATCCCAA-CCCCGCCGATATTTGGCGGG |
Fusarium culmorum EF1a 19 |
(none)
|
GCATCCCAAACCCCGCCGATACTTGGCGGG |
Fusarium graminearum EF1a 20 |
(none)
|
GCATCCCAA-CCCCGCCGACACTTGGCGGG |
Fusarium species EF1a 17 |
(none)
|
GCATCCCAA-CCCCGCCTTCATTTGGCGGG |
Fusarium heterosporum EF1a 15 |
(none)
|
ACCCATGAA-CCCCACCATATGTTGGCTGG |
Fusarium heterosporum EF1a 16 |
(none)
|
ACCCATGAA-CCCCACCATATGTTGGCTGG |
Columns
None of the columns has a description.