@ARTICLE{TreeBASE2Ref18816,
author = {Enith I Rojas and Stephen A Rehner and Gary J Samuels and Sunshine A VanBael and Edward A. Herre and Paul Cannon and Chen Rui and Junfeng Pang and Ruiwu Wang and Yaping Zhang and Yan-Qiong Peng and Tao Sha},
title = {Colletotrichum gloeosporioides s.l. associated with Theobroma cacao and other plants in Panam?: multilocus phylogenies distinguish host-associated pathogens from asymptomatic endophytes},
year = {2010},
keywords = {anthracnose, China, endophyte, multi-locus, Panam?, pathogen},
doi = {},
url = {http://},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {Colletotrichum interacts with numerous plant species overtly as symptomatic pathogens and cryptically as asymptomatic endophytes. It is not known whether these contrasting ecological modes are optional strategies expressed by individual Colletotrichum species or whether a species? ecology is explicitly pathogenic or endophytic. We explored this question by inferring relationships among 77 C. gloeosporioides s.l. strains isolated from asymptomatic leaves and from anthracnose lesions on leaves and fruits of Theobroma cacao (cacao) and other plants from Panam?. ITS and 5?-tef1 were used to assess diversity and to delineate operational taxonomic units for multilocus phylogenetic analysis. The ITS and 5'-tef1 screens concordantly resolved four strongly supported lineages, clades A-D: clade A includes the ex type of C. gloeosporioides, clade C includes the ex type ITS sequence of C. boninense, and clades C and D are unidentified. The ITS yielded limited resolution and support within all clades, in particular the C. gloeosporioides clade (clade A), the focal lineage dealt with in this study. In contrast, the 5?-tef1 screen differentiated nine distinctive haplotype subgroups within the C. gloeosporioides clade that were concordant with phylogenetic terminals resolved in a 5-locus nuclear phylogeny. Among these were two phylogenetic species associated with symptomatic infections specific to either cacao or mango and five phylogenetic species isolated principally as asymptomatic infections from cacao and other plant hosts. We formally describe two new species, C. tropicale and C. ignotum, that are frequent asymptomatic associates of cacao and other Neotropical plant species, and epitypify C. theobromicola, which is associated with foliar and fruit anthracnose lesions of cacao. Asymptomatic Colletotrichum strains isolated from cacao plants grown in China included six distinct C. gloeosporioides clade taxa, only one of which is known to occur in the Neotropics.}
}
Matrix 4983 of Study 10327
Citation title:
"Colletotrichum gloeosporioides s.l. associated with Theobroma cacao and other plants in Panam?: multilocus phylogenies distinguish host-associated pathogens from asymptomatic endophytes".
Study name:
"Colletotrichum gloeosporioides s.l. associated with Theobroma cacao and other plants in Panam?: multilocus phylogenies distinguish host-associated pathogens from asymptomatic endophytes".
This study is part of submission 10317
(Status: Published).
Matrices
Title: Colletotrichum tef1 4
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Colletotrichum tropicale E1164 |
(none)
|
GGTATCGACAAGCGTACCATCGAGAAGTTC |
Colletotrichum tropicale Q633 |
(none)
|
GGTATCGACAAGCGTACCATCGAGAAGTTC |
Colletotrichum sp A2 107 |
(none)
|
??????????????????????????GTTC |
Colletotrichum sp B1 122 |
(none)
|
??????????????????????????GTTC |
Colletotrichum sp B3 131 |
(none)
|
????????????????CCATCGAGAAGTTC |
Colletotrichum sp C2 154 |
(none)
|
????????????????TCATCGAGAAGTTC |
Colletotrichum sp C1 152 |
(none)
|
??????????????????ATCGAGAAGTTC |
Colletotrichum sp C3 155 |
(none)
|
??????????????????ATCGAGAAGTTC |
Colletotrichum sp C3 148 |
(none)
|
?????????????????????????????C |
Colletotrichum sp A2 108 |
(none)
|
?????????????????????????AGTTC |
Colletotrichum sp C3 161 |
(none)
|
?????????????????????????????? |
Colletotrichum sp C3 147 |
(none)
|
?????????????????CATCGAGAAGTTC |
Colletotrichum sp C3 156 |
(none)
|
------------------------------ |
Colletotrichum sp A2 102 |
(none)
|
------------------------------ |
Colletotrichum sp B2 124 |
(none)
|
-------------------TCGAGAAGTTC |
Colletotrichum sp B2 126 |
(none)
|
-----------------CATCGAGAAGTTC |
Colletotrichum sp C2 143 |
(none)
|
------------------------------ |
Colletotrichum sp A2 105 |
(none)
|
----------------------------TC |
Colletotrichum sp B2 165 |
(none)
|
-----------------------------C |
Colletotrichum sp B2 169 |
(none)
|
--------------------------GTTC |
Colletotrichum sp A3 173 |
(none)
|
-------------------TCGAGAAGTTC |
Colletotrichum sp C3 160 |
(none)
|
-----------------CATCGAGAAGTTC |
Colletotrichum sp C2 138 |
(none)
|
------------------------------ |
Colletotrichum sp B2 125 |
(none)
|
------------------------------ |
Colletotrichum sp B2 167 |
(none)
|
------------------------------ |
Colletotrichum sp A3 176 |
(none)
|
------------------------AAGTTC |
Colletotrichum sp indet 2 1091b |
(none)
|
GGTATCGACAAGCGTACCATCGAGAAGTTC |
Colletotrichum sp indet 2 7767b |
(none)
|
GGTATCGACAAGCGTACCATCGAGAAGTTC |
Colletotrichum sp B2 127 |
(none)
|
--------------------------GTTC |
Colletotrichum sp C1 132 |
(none)
|
---------------------GAGAAGTTC |
Colletotrichum sp C1 134 |
(none)
|
------------------ATCGAGAAGTTC |
Colletotrichum sp C2 136 |
(none)
|
-----------------CATCGAGAAGTTC |
Colletotrichum theobromicola GJS08 47 |
(none)
|
GGTATCGACAAGCGTACCATCGAGAAGTTC |
Colletotrichum theobromicola GJS08 51 |
(none)
|
GGTATCGACAAGCGTACCATCGAGAAGTTC |
Columns
None of the columns has a description.