@ARTICLE{TreeBASE2Ref17340,
author = {Juan Armando Sanchez and Derek J. Taylor},
title = {Phylogenetic Analyses Among Octocorals (Cnidaria): Mitochondrial and Nuclear DNA Sequences (lsu-rRNA, 16S and ssu-rRNA, 18S) Support Two Convergent Clades of Branching Gorgonians.},
year = {2003},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Gorgonian octocorals lack corroborated hypotheses of phylogeny. This study reconstructs genealogical relationships among some octocoral species based on published DNA sequences from the large ribosomal subunit of the mitochondrial RNA (lsu-rRNA, 16S: 524 bp and 21 species) and the small subunit of the nuclear RNA (ssu-rRNA, 18S: 1815 bp and 13 spp) using information from insertions-deletions (INDELS) and the predicted secondary structure of the lsu-rRNA (16S). There were seven short (3-10 bp) INDELS in the 18S with consistent phylogenetic information. The INDELS in the 16Scorresponded to informative signature sequences homologous to the G13 helix found in Escherichia coli. We found two main groups of gorgonian octocorals using a maximum parsimony analysis of the two genes. One group corresponds to deep-water taxa including species from the suborders Calcaxonia and Scleraxonia characterized by an enlargement of the G13 helix. The second group has species from Alcyoniina, Holaxonia and again Scleraxonia characterized by insertions in the 18S. Gorgonian corals, branching colonies with a gorgonin-containing flexible multilayered axis (Holaxonia and Calcaxonia), are a polyphyletic set of species. These corroborated results from maternally inherited (16S) and biparentally inherited (18S) genes support a hypothesis of parallel evolution of branching in the two octocoral clades.}
}
Matrix 505 of Study 969
Citation title:
"Phylogenetic Analyses Among Octocorals (Cnidaria): Mitochondrial and Nuclear DNA Sequences (lsu-rRNA, 16S and ssu-rRNA, 18S) Support Two Convergent Clades of Branching Gorgonians.".
This study was previously identified under the legacy study ID S853
(Status: Published).
Matrices
Title: 18S rRNA
Description: Legacy TreeBASE Matrix ID = M1386
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Lepidisis sp |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Narella nuttingi |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Narella bowersi |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Chrysogorgia chryseis |
(none)
|
CCTGCCAGTAACATATGCTTGTCTCAAAGA |
Lophogorgia chilensis |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Acanthogorgia sp |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Corallium ducale |
(none)
|
CCTGCCAGTAACATATGCTTGTCTCAAAGA |
Corallium kishinouyei |
(none)
|
CCTGCCAGTAACATATGCTTGTCTCAAAGA |
Paragorgia sp |
(none)
|
CCTGCCAGTAACATATGCTTGTCTCAAAGA |
Anthothela nuttingi |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Protodendron sp |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Alcyonium gracillimum |
(none)
|
CCTGCCAGTATCATATGCTTGTCTCAAAGA |
Renilla reniformis |
(none)
|
CCTGCCAGTAACATATGCTTGTCTCAAAGA |
Columns
None of the columns has a description.