@ARTICLE{TreeBASE2Ref15740,
author = {Francis A. Harrington and Daniel Potter},
title = {Phylogenetic relationships within Sarcoscypha (Sarcoscyphineae, Pezizales) based upon nucleotide sequences of the internal transcribed spacer of nuclear ribosomal DNA.},
year = {1997},
keywords = {cladistics; ITS; Pezizales; phylogeny; Sarcoscyphaceae},
doi = {},
url = {http://www.jstor.org/stable/3761080},
pmid = {},
journal = {Mycologia},
volume = {89},
number = {2},
pages = {258--267},
abstract = {Nucleotide sequences of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA (including the 5.8S ribosomal RNA gene and the flanking ITS1 and ITS2 regions) were used as characters in a phylogenetic analysis of species of Sarcoscypha. The sequences of the ITS regions for 25 isolates, representing fourteen (nine described and five putative new) species of Sarcoscypha, and three outgroup species, Pithya vulgaris, P. cupressina, and Phillipsia domingensis, were determined in both directions using primers ITS1, ITS2, ITS3, and ITS4. The complete sequences ranged from 485 to 764 base pairs in length; they were aligned using the program MALIGN. The sequence of Phillipsia domingensis was highly divergent from that of the other taxa; the alignment was therefore repeated excluding that taxon and subsequent phylogenetic analyses included only the species of Sarcoscypha and one outgroup, Pithya cupressina. The complete alignment contained 907 base pair sites; 446 of these were considered ambiguously aligned and were excluded from phylogenetic analyses. Of the remaining 461 base pair sites, 91 were variable with 43 potentially informative characters. Cladistic analysis yielded two equally parsimonious cladograms with NONA (these corresponded to two fully supported trees of the eight trees found by Hennig86). In all most parsimonious trees, two Asian species, S. striatispora and S. vassiljevae, fell outside of a core group of twelve species which were grouped in two major clades, each including taxa from North America, Europe and Asia. One clade included the following species: S. austriaca, S. coccinea, S. macaronesica, and two putative new species. This clade was divided into two subclades: one consisted of S. macaronesica and S. coccinea, while, in the second, one putative new species from Japan (sp. A) was sister to a polytomy including the putative new species from Taiwan (sp. B) and the S. austriaca isolates from Europe and North America. The other major clade included S. dudleyi and S. emarginata, whose positions varied among the equally parsimonious trees, and a subclade in which the second new species from Japan (sp. D) was sister to a polytomy of S. occidentalis, an isolate of S. javensis,and two putative new species (sp. E from China and sp. C from Hawaii). In all cases where more than one isolate of the same species was included, those isolates grouped together within each clade, although relationships among the three isolates of S. austriaca and the one of S. sp. B were unresolved. A new combination is made for Peziza emarginata Berk. & Broome.}
}
Matrix 662 of Study 254
Citation title:
"Phylogenetic relationships within Sarcoscypha (Sarcoscyphineae, Pezizales) based upon nucleotide sequences of the internal transcribed spacer of nuclear ribosomal DNA.".
This study was previously identified under the legacy study ID S9x6x96c10c33c05
(Status: Published).
Matrices
Title: unpublished
Description: Legacy TreeBASE Matrix ID = M156c9x6x96c10c39c16
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pithya cupressina |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha vassiljevae |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAACC |
Sarcoscypha striatispora |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha austriaca Norway |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha austriaca NY |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha austriaca Slovakia |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha coccinea CA |
(none)
|
AAGTCGTAA-AAGGTTTCCGTAGGTGAA-C |
Sarcoscypha coccinea WA |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha coccinea OR |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha dudleyi FL |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha dudleyi NY |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha emarginata Luxembou |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha emarginata Switzerl |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha macaronesica Gomera |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha macaronesica Teneri |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha occidentalis OH |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha occidentalis PN |
(none)
|
AAGTCGTAACAAGGTTTCTGTAGGTGAA-C |
Sarcoscypha javensis |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha sp E |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha sp B |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha sp C |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha sp A |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Sarcoscypha sp D |
(none)
|
AAGTCGTAACAAGGTTTCCGTAGGTGAA-C |
Columns
None of the columns has a description.