@ARTICLE{TreeBASE2Ref18072,
author = {Jonathan M. Waters and Michael S Roy},
title = {Out of Africa: the slow train to Australasia.},
year = {2004},
keywords = {},
doi = {10.1080/10635150490264671},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {53},
number = {1},
pages = {18--24},
abstract = {We used mitochondrial DNA sequences to test biogeographic hypotheses for Patiriella exigua (Asterinidae), one of the world's most widespread coastal sea-stars. This small intertidal species has an entirely benthic life-history and yet occurs in southern temperate waters of the Atlantic, Indian and Pacific oceans. Despite its abundance around southern Africa, south-eastern Australia, and several oceanic islands, P. exigua is absent from the shores of Western Australia, New Zealand, and South America. Phylogenetic analysis of mtDNA sequences (COI, control region) indicates that South Africa houses an assemblage of P. exigua that is not monophyletic (P = 0.04), whereas Australian and Lord Howe Island specimens comprise an interior monophyletic group. The placement of the root in Africa, and small genetic divergences (1.1-1.9%) between eastern African and Australian haplotypes, strongly suggests Pleistocene dispersal eastwards across the Indian Ocean. Dispersal was probably achieved by rafting on wood or macroalgae, facilitated by the West Wind Drift. Genetic data also support Pleistocene colonisation of oceanic islands (Lord Howe Island, Amsterdam Island, St Helena). Although many biogeographers have speculated about the role of long-distance rafting, this study is one of the first to provide convincing evidence. The marked phylogeographic structure evident across small geographic scales in Australia and South Africa indicates that gene flow among populations may be generally insufficient to prevent the local evolution of monophyly. We suggest that P. exigua may rely on passive mechanisms of dispersal.}
}
Matrix 685 of Study 1065
Citation title:
"Out of Africa: the slow train to Australasia.".
This study was previously identified under the legacy study ID S962
(Status: Published).
Matrices
Title: COI + control region
Description: Legacy TreeBASE Matrix ID = M1594
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Patiriella exigua AM.1 |
(none)
|
??????????????????CTTATGATCGGA |
Patiriella exigua AM.2 |
(none)
|
???????????????????TTATGATCGGA |
Patiriella exigua CT.1 |
(none)
|
???????GACTAATTCCCCTTATGATCGGA |
Patiriella exigua CT.4 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATCGGA |
Patiriella exigua CT.6 |
(none)
|
???????GACTAATTCCCCTTATGATCGGA |
Patiriella exigua DB.1 |
(none)
|
???????GACTAATTCCCCTTATGATTGGA |
Patiriella exigua DB.2 |
(none)
|
???????GACTAATTCCCCTTATGATTGGA |
Patiriella exigua DB.5 |
(none)
|
????ATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua DB.6 |
(none)
|
?????????????????????????????? |
Patiriella exigua LH.1 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua LH.3 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua NB.1 |
(none)
|
????????????????????????ATTGGA |
Patiriella exigua NB.3 |
(none)
|
?????????????????????????????? |
Patiriella exigua NB.4 |
(none)
|
?????????????????????????????? |
Patiriella exigua NM.2 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua NM.3 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua PJ |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua SH.1 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua TT.1 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua TT.2 |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua TW.1 |
(none)
|
GGGAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua TW.3 |
(none)
|
GGGAATTGACTAATTCCCCTTATGATTGGA |
Patiriella exigua VF.1 |
(none)
|
???????GACTAATTCCCCTTATGATTGGA |
Patiriella exigua VO |
(none)
|
GGAAATTGACTAATTCCCCTTATGATTGGA |
Patiriella parvivipara H97 |
(none)
|
GGAAACTGACTGATTCCCCTTATGATTGGA |
Patiriella regularis |
(none)
|
GGAAACTGACTTATACCCCTAATGATAGGA |
Patiriella vivipara H97 |
(none)
|
GGAAACTGACTGATTCCCCTTATGATTGGG |
Patiriella vivipara TW |
(none)
|
GGAAACTGACTGATTCCCCTTATGATTGGG |
Columns
None of the columns has a description.