@ARTICLE{TreeBASE2Ref15616,
author = {Barbara Gravendeel and Marcel C. M. Eurlings and Cassio van den Berg and Phillip J. Cribb},
title = {Phylogeny of Pleione (Orchidaceae) and parentage analysis of its wild hybrids based on plastid and nrITS sequences and morphological data.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Phylogenetic relationships within the orchid genus Pleione were reconstructed using maximum parsimony analyses of plastid and nuclear DNA and morphology for 21 taxa to evaluate subgeneric groups, controversial species delimitations, and parentage of several putative wild hybrids. Separate analyses of each data set produced mainly congruent clades when P. x confusa and the Chinese accession of P. hookeriana were excluded. Analysis of the combined data indicated that traditional divisions of the genus into various subgenera and sections are supported when they are based on apomorphic characters. Sections found to be paraphyletic are based on homoplasious and plesiomorphic characters. For a subgeneric classification of Pleione based on phylogenetic relationships three groups are suggested. Taxa within the P. bulbocodioides complex do not show much molecular divergence. Pleione maculata and P. praecox are proposed to be the paternal and maternal parent of P. x lagenaria, respectively, as their nuclear and plastid genomes were almost identical to their natural hybrid. Furthermore, DNA sequences confirm the paternal and maternal parent origin of P. x confusa from P. forrestii and P. albiflora as already suggested by morphological and karyotype data. Molecular data are not conclusive about parentages of P. x taliensis.}
}
Matrix 752 of Study 1094
Citation title:
"Phylogeny of Pleione (Orchidaceae) and parentage analysis of its wild hybrids based on plastid and nrITS sequences and morphological data.".
This study was previously identified under the legacy study ID S999
(Status: Published).
Matrices
Title: trnTtrnL
Description: Legacy TreeBASE Matrix ID = M1681
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Thunia alba |
(none)
|
CGGGCGGATATAAGAGCAATAGTGTATAGG |
Dendrochilum longifolium |
(none)
|
CGGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione xlagenaria |
(none)
|
?GGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione hookerianaxchunii |
(none)
|
CGGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione yunnanensis |
(none)
|
?GGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione xtaliensis |
(none)
|
????CGGATATAAGAGCAATAGTGTATAGG |
Pleione scopulorum |
(none)
|
?GGGCGGATATAAGAGCAATAGTTTATAGG |
Pleione saxicola |
(none)
|
?GGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione pleionoides309 |
(none)
|
?GGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione pleionoides308 |
(none)
|
??????GATATAAGAGCAATAGTGTATAGG |
Pleione praecox |
(none)
|
?GGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione maculata |
(none)
|
??GGCGGATATAAGAGCAATAGTGTATAGG |
Pleione limprichtii |
(none)
|
??GGCGGATATAAGAGCAATAGTGTATAGG |
Pleione humilis |
(none)
|
?????GGATATAAGAGCAATAGTGTATAGG |
Pleione hookeriana406India |
(none)
|
???????ATATAAGAGCAATAGTGTATAGG |
Pleione hookeriana322China |
(none)
|
????CGGATATAAGAGCAATAGTGTATAGG |
Pleione grandiflora |
(none)
|
?????GGATATAAGAGCAATAGTGTATAGG |
Pleione forrestii |
(none)
|
CGGGCGGATATAAGAGCAATAGTGTATAGG |
Pleione formosana |
(none)
|
????CGGATATAAGAGCAATAGTGTATAGG |
Pleione coronaria |
(none)
|
??GGCGGATATAAGAGCAATAGTGTATAGG |
Pleione xconfusa |
(none)
|
??GGCGGATATAAGAGCAATAGTGTATAGG |
Pleione chunii |
(none)
|
?????GGATATAAGAGCAATAGTGTATAGG |
Pleione bulbocodioides313 |
(none)
|
?????????????GAGCAATAGTGTATAGG |
Pleione delavayi |
(none)
|
????????????????????????????GG |
Pleione albiflora |
(none)
|
?GGGCGGATATAAGAGCAATAGTGTATAGG |
Columns
None of the columns has a description.