@ARTICLE{TreeBASE2Ref19535,
author = {Pedro W. Crous and Johannes (Ewald) Zacharias Groenewald},
title = {Why everlastings don?t last},
year = {2011},
keywords = {Batcheloromyces, Catenulostroma, Cladosporium, Devriesia, Exophiala, ITS, LSU, Penicillium, Penidiella, Phaenocoma prolifera, systematics, Teratosphaeria, Toxicocladosporium, Xenophacidiella},
doi = {10.3767/003158511X574532},
url = {http://www.persoonia.org},
pmid = {},
journal = {Persoonia},
volume = {26},
number = {},
pages = {70--84},
abstract = {The Cape Floral Region represents one of the world?s biodiversity hot spots, with a high level of plant, animal and insect endemism. The fungi occurring in this region, however, remain poorly studied. It is widely postulated that each plant species should harbour at least five to six unique fungal species, a number that we regard to be a huge underestimate. To test this hypothesis, we decided to study a single senescent flower of Phaenocoma prolifera (?everlasting?; Asteraceae) collected in South Africa, and posed the question as to how many different species of fungi could be isolated and cultivated from 10 leaf bracts. Using a damp chamber technique, numerous microfungi could be induced to sporulate, enabling most of them to be successfully isolated on artificial agar media. Isolates were subsequently subjected to DNA sequencing of the ITS and LSU nrDNA regions. During the course of this study 17 species could be cultivated and identified, of which 11 appeared to be new to science. These include Catenulostroma hermanusense, Cladosporium phaenocomae, Devriesia tardicrescens, Exophiala capensis, Penidiella aggregata, P. ellipsoidea, Teratosphaeria karinae, Toxicocladosporium pseudoveloxum spp. nov., and Xenophacidiella pseudocatenata gen. et sp. nov. Further studies are now required to determine if these fungi also occur as endophytes in healthy flowers. If this trend holds true for other plant hosts from southern Africa, it would suggest that there are many more fungi present in the Cape Floral Region than estimated in previous studies.}
}
Matrix 8039 of Study 11288
Citation title:
"Why everlastings don?t last".
Study name:
"Why everlastings don?t last".
This study is part of submission 11278
(Status: Published).
Matrices
Title: Combined
Description: Combined ITS, ACT and TEF for Cladosporium species
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Cercospora beticola CPC 11557 |
(none)
|
------------------------------ |
Cladosporium exile CBS 125987 |
(none)
|
------------------------------ |
Cladosporium phaenocomae CPC 18221 |
(none)
|
------------------------------ |
Cladosporium phaenocomae CPC 18223 |
(none)
|
ATTGAATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium australiense CBS 125984 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium pseudocladosporioides CBS 125993 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium pseudocladosporioides CPC 14193 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium pseudocladosporioides CPC 14001 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium cladosporioides CPC 18230 |
(none)
|
ATTGAATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium cladosporioides CPC 14018 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium cladosporioides CPC 12214 |
(none)
|
------------------------------ |
Cladosporium cladosporioides CPC 11161 |
(none)
|
------------------------------ |
Cladosporium cladosporioides CPC 14019 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium cladosporioides CBS 112388 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium iranicum CBS 126346 |
(none)
|
------------------------------ |
Cladosporium perangustum CPC 18228 |
(none)
|
ATTGAATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium perangustum CPC 18229 |
(none)
|
ATTGAATGGCTCGGTGAGGC?TTCGGACTG |
Cladosporium perangustum CPC 15192 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium perangustum CPC 13774 |
(none)
|
------TGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium perangustum CBS 125996 |
(none)
|
-----ATGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium perangustum CPC 14247 |
(none)
|
------TGGCTCGGTGAGGCCTTCGGACTG |
Cladosporium perangustum CPC 11819 |
(none)
|
------------------------------ |
Cladosporium ramotenellum CPC 12043 |
(none)
|
------------------------------ |
Cladosporium ramotenellum CPC 12047 |
(none)
|
------------------------------ |
Cladosporium ramotenellum CPC 18224 |
(none)
|
ATTGAATGGCTCGGTGAGGCCTTCGGACTG |
Columns
None of the columns has a description.