Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 8258 of Study 11330
Citation title: "A phylogenetic analysis of morphological and molecular characters of Lithospermum L. (Boraginaceae) and related taxa: evolutionary relationships and character evolution".
Study name: "A phylogenetic analysis of morphological and molecular characters of Lithospermum L. (Boraginaceae) and related taxa: evolutionary relationships and character evolution".
This study is part of submission 11320
(Status: Published).
Matrices
Title: 10 locus cpDNA
Description: 10 cpDNA regions
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Antiphytum floribundum | (none) | ????????????????????ATTGATATGT |
| Arnebia benthamii | (none) | ?????????????????????????????? |
| Lithospermum strictum | (none) | ???????????????????????GATATGT |
| Lithospermum caroliniense | (none) | ?????????????????????????????? |
| Lithospermum macromeria | (none) | ?????????????????????????????? |
| Lithospermum cobrense | (none) | ?????????????????????????????? |
| Lithospermum canescens | (none) | ?????????????????????????????? |
| Lithospermum multiflorum | (none) | ?????????????????????????????? |
| Lithospermum distichum | (none) | ?????????????????????????????? |
| Lithospermum tuberosum | (none) | ?????????????????????????????? |
| Lithospermum johnstonii | (none) | ?????????????????????TTGATATGT |
| Lithospermum molle | (none) | ?????????????????????????????? |
| Lithospermum officinale | (none) | ?????????????????????????????? |
| Lithospermum erythrorhizon | (none) | ?????????????????????????????? |
| Lithospermum notatum | (none) | ?????????????????????????????? |
| Lithospermum matamorense | (none) | ?????????????????????????????? |
| Lithospermum flavum | (none) | ?????????????????????????????T |
| Lithospermum ruderale | (none) | ?????????????????????????????? |
| Lithospermum californicum | (none) | AAAGGGTATGATCCACGCATATTGATATGT |
| Lithospermum calcicola | (none) | ?????????????????????????????? |
| Lithospermum revolutum | (none) | ????????????????????ATTGATATGT |
| Lithospermum trinervium | (none) | ??????????????????????????ATGT |
| Lithospermum discolor | (none) | ????????TGATCCACGCATATTGATATGT |
| Lithospermum leonotis | (none) | ?????????????????????????????? |
| Cynoglossum amabile | (none) | ?????????????????????????????? |
| Lindelofia longiflora | (none) | ?????????????????????????????? |
| Lithospermum mirabile | (none) | ??AAGGTATGATCCACGCATATTGATATGT |
| Lithospermum viride | (none) | ?????????????????????????????? |
| Lithospermum nelsonii | (none) | ?????????????????????????????? |
| Lithospermum rosei | (none) | ?????????????????????????????? |
| Lithospermum exsertum | (none) | ?????????????????????????????? |
| Lithospermum calycosum | (none) | ?????????????????????????????? |
| Lithospermum mirabile x incisum | (none) | ?????????????????????????????? |
| Lithospermum tubuliflorum | (none) | ?????????????????????TTGATATGT |
| Lithospermum latifolium | (none) | ?????????????????????????????? |
| Amsinckia tessellata | (none) | ?????????????????????????????? |
| Cynoglossum pringlei | (none) | ?????????????????????????????? |
| Mertensia virginica | (none) | ?????????????????????????????? |
| Omphalodes verna | (none) | ?????????????????????????????? |
| Omphalodes cappadocica | (none) | ?????????????????????????????? |
| Anchusa leptophylla | (none) | ??????????????????????TGAAATGT |
| Symphytum asperum | (none) | ?????????????????????????????? |
| Trachystemon orientalis | (none) | ??????????????????????????ATGT |
| Lithodora zahnii | (none) | ?????????????????????????????T |
| Lithodora hispidula | (none) | ???????????????????????GATATGT |
| Moltkia petraea | (none) | ?????????????????????????????? |
| Glandora diffusa | (none) | ?????????????????????????????? |
| Onosma stellulata | (none) | ?????????????????????????????? |
| Cerinthe major | (none) | ?????????????????????????????? |
| Buglossoides arvense | (none) | ?????????????????????????????? |
| Echium vulgare | (none) | ??????????????????????TGATATGT |
| Buglossoides purpureo-caerulea | (none) | ?????????????????????????????? |
| Glandora oleifolia | (none) | ?????????????????????TTGATATGT |
| Lithospermum oblongifolium | (none) | ?????????????????????????????? |
| Lithospermum obovatum | (none) | ?????????????????????????????? |
| Lithospermum helleri | (none) | ?????????????????????????????? |
| Lithospermum scabrum | (none) | ???????????????????TATTGATATGT |
| Buglossoides tenuiflora | (none) | ?????????????????????????????? |
| Halacsya sendtneri | (none) | ?????????????????????????????? |
| Neatostema apulum | (none) | ?????????????????????????????? |
| Mairetis microsperma | (none) | ?????????????????????????????? |
| Paramoltkia doerfleri | (none) | ?????????????????????????????? |
| Lithospermum cinereum | (none) | ?????????????????????????????? |
| Lithospermum gayanum | (none) | ?????????????????????????????? |
| Buglossoides incrassata | (none) | ?????????????????????????????? |
| Maharanga emodi | (none) | ?????????????????????????????? |
| Podonosma orientalis | (none) | ?????????????????????????????? |
Columns
None of the columns has a description.
