@ARTICLE{TreeBASE2Ref16988,
author = {Niklas Pedersen and David T. Holyoak and Angela E. Newton},
title = {Systematics and morphological evolution within the moss family Bryaceae: a comparison between parsimony and Bayesian methods for reconstruction of ancestral character states},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {The Bryaceae are a large cosmopolitan moss family including genera of significant morphological and taxonomic complexity. Phylogenetic relationships within the Bryaceae were reconstructed based on DNA sequence data from all three genomic compartments. In addition, maximum parsimony and Bayesian inference were employed to reconstruct ancestral characters states of 38 morphological plus four habitat characters and eight insertion/deletion events. The recovered phylogenetic patterns are generally in accord with previous phylogenies based on chloroplast DNA sequence data and three major clades are identified. The first clade comprises Bryum bornholmense, B. rubens, B. caespiticium, and Plagiobryum. This corroborates the hypothesis suggested by previous studies that several Bryum species are more closely related to Plagiobryum than to the core Bryum species. The second clade includes Acidodontium, Anomobryum, and Haplodontium, while the third clade contains the core Bryum species plus Imbribryum. Within the latter clade, B. subapiculatum and B. tenuisetum form the sister clade to Imbribryum. Reconstructions of ancestral character states under maximum parsimony and Bayesian inference suggest fourteen morphological synapomorphies for the ingroup and synapomorphies are detected for most clades within the ingroup. Maximum parsimony and Bayesian reconstructions of ancestral character states are mostly congruent although Bayesian inference shows that the posterior probability of ancestral character states may decrease dramatically when node support is taken into account. Bayesian inference also indicates that reconstructions may be ambiguous at internal nodes for highly polymorphic characters.}
}
Matrix 886 of Study 1688
Citation title:
"Systematics and morphological evolution within the moss family Bryaceae: a comparison between parsimony and Bayesian methods for reconstruction of ancestral character states".
This study was previously identified under the legacy study ID S1650
(Status: Published).
Matrices
Title: Sequence_data
Description: Legacy TreeBASE Matrix ID = M2982
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Bryum violaceum |
(none)
|
---------CA-CGTTAGCTTGGAAGGCTA |
Bryum versicolor |
(none)
|
---------------TAGCTTGGAAGGCTA |
Bryum tenuisetum |
(none)
|
--TACCCG-CATCGTTAGCTTGGAAGGCTA |
Bryum subapiculatum |
(none)
|
---------CA-CGTTAGCTTGGAAGGCTA |
Bryum sauteri |
(none)
|
------------------------------ |
Bryum ruderale |
(none)
|
--TACCCGGCATCGTTAGCTTGGAAGGCTA |
Bryum rubens |
(none)
|
-----------ACGTTAGCTTGGAAGGCTA |
Bryum radiculosum |
(none)
|
----------------AGCTTGGAAGGCTA |
Plagiobryum pseudotriquetrum |
(none)
|
---------CATCGTTAGCTTGGAAGGCTA |
Bryum gemmiparum |
(none)
|
---------CATCGTTAGCTTGGAAGGCTA |
Bryum gemmilucens |
(none)
|
----------ATTGTTAGCTTGGAAGGCTA |
Bryum gemmiferum |
(none)
|
---ACCCG-CATCGTTAGCTTGGAAGGCTA |
Bryum dyffrynense |
(none)
|
---------CATCGTTAGCTTGGAAGGCTA |
Bryum dunense |
(none)
|
-----CCCGCATCGTTAGCTTGGAAGGCTA |
Plagiobryum cyclophyllum |
(none)
|
------------------------------ |
Bryum coronatum |
(none)
|
---ACCC-GCATCGTTAGCTTGGAAGGCTA |
Plagiobryum capillare |
(none)
|
--TACCCGGCATCGTTAGCTTGGAAGGCTA |
Bryum caespiticium |
(none)
|
--TACCC-GCATCGTTAGCTTGGAAGGCTA |
Bryum bornholmense |
(none)
|
-------------GTTAGCTTGGAAGGCTA |
Bryum bicolor |
(none)
|
---ACCC-GCATCGTTAGCTTGGAAGGCTA |
Bryum barnesii |
(none)
|
---------CA-CGTTAGCTTGGAAGGCTA |
Bryum argenteum |
(none)
|
TTTAACCCGCATCGTTAGCTTGGAAGGCTA |
Imbribryum alpinum |
(none)
|
---TACCCGCATCGTTAGCTTGGAAGGCTA |
Rhodobryum roseum |
(none)
|
---TACCCGCATCGTTAGCTTGGAAGGCTA |
Plagiobryum zieri |
(none)
|
---TACCCGCATCGTTAGCTTGGAAGGCTA |
Haplodontium reticulatum |
(none)
|
------------------------------ |
Haplodontium megalocarpum |
(none)
|
--------------GTAGCTTGGAAGGCTA |
Brachymenium nepalense |
(none)
|
------------------------------ |
Brachymenium capitulatum |
(none)
|
------------------------------ |
Anomobryum prostratum |
(none)
|
------------------------------ |
Anomobryum julaceum |
(none)
|
-------------CGTAGCTTGGAAGGCTA |
Anomobryum humillimum |
(none)
|
----------------------------TA |
Acidodontium seminerve |
(none)
|
------------------------------ |
Acidodontium ramicola |
(none)
|
------------------------------ |
Acidodontium heteroneuron |
(none)
|
----------------AGCTTGGAAGGCTA |
Columns
None of the columns has a description.