@ARTICLE{TreeBASE2Ref15246,
author = {Bryn T. M. Dentinger and David J. McLaughlin},
title = {Reconstructing the Clavariaceae using nuclear large subunit rDNA sequences and a new genus segregated from Clavaria},
year = {2006},
keywords = {Actiniceps, agaric, Chaetotyphula, clamp connection, coral mushroom, Dimorphocystis, Eumycota, Holocoryne, Hymenomycetes, Macrotyphula, molecular systematics, morphological evolution, Physalacria, Typhula},
doi = {10.3852/mycologia.98.5.746},
url = {},
pmid = {},
journal = {Mycologia},
volume = {98},
number = {5},
pages = {746--762},
abstract = {Fungi that produce clavarioid fruitbodies have evolved independently many times in the Basidiomycota. The evolutionary significance of this morphology is difficult to interpret because the phylogenetic positions of many clavarioid fungi are still unknown. In this study, we examined the phylogenetic diversity of the Clavariaceae sensu lato among Homobasidiomycetidae by adding partial nuclear large subunit ribosomal DNA sequences from clavarioid and corticioid fungi to a large euagaric dataset, and analyzing them both together and separately. Our results confirm that the clavarioid morphology has evolved multiple times within the euagarics, and that these may be reduced fruitbody types that have been repeatedly derived from agaricoid or corticioid ancestors. In some cases it was difficult to determine phylogenetic affinities of certain taxa due to ambiguous or dubious identifications of sequences downloaded from GenBank, while in other cases our results were more clear. We propose the new genus Alloclavaria to accommodate Clavaria purpurea, which is not related to Clavaria, but is derived within the hymenochaetoid clade. The Clavariaceae needs redefinition to reflect a monophyletic group and the limits of Clavaria, Clavulinopsis, and Ramariopsis should be reconsidered when additional data are available.}
}
Matrix 910 of Study 1699
Citation title:
"Reconstructing the Clavariaceae using nuclear large subunit rDNA sequences and a new genus segregated from Clavaria".
This study was previously identified under the legacy study ID S1661
(Status: Published).
Matrices
Title: Chaetotyphula clade 28S rDNA
Description: Legacy TreeBASE Matrix ID = M3003
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pleurotopsis longinqua |
(none)
|
AACTGCGAGTGAAGAGGGAAAAGCTCAAAT |
Pistillaria sp. DJM1031 |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Mycena aurantiidisca |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Mycena adonis |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Hemimycena ignobilis |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Hemimycena delicatella |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Chaetotyphula sp. BDCR0419 2C |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Chaetotyphula hyalina |
(none)
|
A-CTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Calyptella capula |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Bioluminescent mycenoid |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Actiniceps laevis |
(none)
|
AACTGCGAGTGAAGCGGGAAAAGCTCAAAT |
Columns
None of the columns has a description.