@ARTICLE{TreeBASE2Ref19785,
author = {Miles J McKenna and Mark P Simmons and Christine Dorothy Bacon and Julio A. Lombardi},
title = {Delimitation of the Segregate Genera of Maytenus sensu lato (Celastraceae) Based on Morphological and Molecular Characters.},
year = {2010},
keywords = {Denhamia, Gloveria, Gymnosporia, Moya, Putterlickia, Tricerma},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Maytenus sensu lato (including Gymnosporia) is a morphologically diverse genus of about 300 species that is widely distributed in the tropics and subtropics of both the Old and New Worlds. Its delimitation has been extensively debated and despite the segregation of Gymnosporia, Maytenus sensu stricto remains a heterogeneous, polyphyletic group. In order to delimit natural segregate genera we increased taxon sampling and generated sequences from two nuclear gene regions (ITS and 26S rDNA) and two plastid loci (matK and trnL-F) to analyze together with morphological characters. Both Moya and Tricerma were found to be nested within the New World Maytenus and are recognized as synonyms of Maytenus sensu stricto. In contrast, the three New World species of Gymnosporia are recognized as a new genus that is closely related to Gyminda. Haydenia is erected for these three species: H. gentryi, H. haberiana, and H. urbaniana. One or more previously proposed or novel genera are required to accommodate the systematically difficult African Maytenus. Putterlickia, and most likely Gloveria, are nested within Gymnosporia and should be synonymized with that genus. New binomials are required for four Chinese and one Rapan species of Gymnosporia that have been previously treated only as Maytenus: Gymnosporia austroyunnanensis, G. confertiflora, G. dongfangensis, G. guangxiensis, and G. pertinax. Austral-Pacific Maytenus are transferred to Denhamia, requiring eight new binomials: Denhamia bilocularis, D. cunninghamii, D. cupularis, D. disperma, D. fasciculiflora, D. ferdinandii, D. fournieri, and D. silvestris. Existing intrageneric classifications of Gymnosporia and Maytenus sensu stricto were not supported in their entirety. Gymnosporia is inferred to have had an African origin followed by dispersals to Madagascar, southeast Asia and the Austral-Pacific.}
}
Matrix 9117 of Study 11610
Citation title:
"Delimitation of the Segregate Genera of Maytenus sensu lato (Celastraceae) Based on Morphological and Molecular Characters.".
Study name:
"Delimitation of the Segregate Genera of Maytenus sensu lato (Celastraceae) Based on Morphological and Molecular Characters.".
This study is part of submission 11600
(Status: Published).
Matrices
Title: Gymnosporia DNA
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Allocassine laurifolia |
(none)
|
---------------------AAGGATCAT |
Cassine peragua |
(none)
|
---------------------AAGGATCAT |
Cassine schinoides |
(none)
|
---------------------AAGGATCAT |
Catha edulis 1896 |
(none)
|
---------------------AAGGATCAT |
Catha edulis 3016 |
(none)
|
----------------TGCGGAAGGATCAT |
Gymnosporia arbutifolia |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia cassinoides 2201 |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia cassinoides 3525 |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia crenata |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia divaricata |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia diversifolia |
(none)
|
TTTCCGTAGGTGAACTTGCGGAAGGATCAT |
Gymnosporia engleriana |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia grossulariae |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia harveyana |
(none)
|
-----GTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia inermis |
(none)
|
------------------------------ |
Gymnosporia littoralis |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia madagascariensis |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia mossambicensis |
(none)
|
-----GTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia palauica |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia polyacantha |
(none)
|
?????????????????????????????? |
Gymnosporia pyria |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia royleana |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia senegalensis |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Gymnosporia wallichiana |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Lauridia reticulata |
(none)
|
---------------------AAGGATCAT |
Lauridia tetragona |
(none)
|
---------------------AAGGATCAT |
Lydenburgia abbottii |
(none)
|
---------------------AAGGATCAT |
Lydenburgia cassinoides |
(none)
|
-------------------------ATCAT |
Maurocenia frangula |
(none)
|
---------------------AAGGATCAT |
Maytenus pertinax |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Putterlickia pyracantha |
(none)
|
TTTCCGTAGGTGAACCTGCGGAAGGATCAT |
Putterlickia verrucosa |
(none)
|
---------------------AAGGATCAT |
Columns
None of the columns has a description.