@ARTICLE{TreeBASE2Ref16004,
author = {Zhen Jiao and Jianhua Li},
title = {Phylogeny and biogeography of intercontinental disjunct Gelsemiaceae inferred from chloroplast and nuclear DNA sequences},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Gelsemiaceae consist of two intercontinental disjunct genera: Gelsemium (3 species) and Mostuea (9 species). Gelsemium is distributed in eastern Asia and North America, while Mostuea is disjunct between South America and Africa. In this study, sequences of three chloroplast genes (ndhF, rbcL, and matK) and the external transcribed spacer of the ribosomal DNA region were used to examine phylogenetic relationships and biogeography of Gelsemiaceae. Our results support the monophyly of Gelsemiaceae, Mostuea, and Gelsemium; however, more data are needed to resolve relationships of Gelsemiaceae with other families of Gentianales. Within Mostuea, M. surinamensis of South America is sister to the clade containing African species, indicating that it is unlikely that M. surinamensis is an introduced species from Africa. The relationship agrees with seed pubescence. North American species of Gelsemium form a clade that is sister to G. elegans of eastern Asia, which is consistent with flower and fruit morphology. The estimated times of divergence are at least 21.2?0.7 mya between Gelsemium and Mostuea, 8.4?0.8 mya between eastern Asian and North American species of Gelsemium, 2.9?0.4 mya between G. sempervirens and G. rankinii, and 7.29?0.4 between South American and African species of Mostuea. Similar divergence times between the two intercontinental disjunctions support the proposition that Laurasian migration has played an important role in the formation of Gondwanan disjunctions. Given the broadleaved growth habit and ecology of Gelsemiaceae, the North Atlantic land bridge may be the main route for population exchanges between the continents.}
}
Matrix 924 of Study 1703
Citation title:
"Phylogeny and biogeography of intercontinental disjunct Gelsemiaceae inferred from chloroplast and nuclear DNA sequences".
This study was previously identified under the legacy study ID S1666
(Status: Published).
Matrices
Title: cp combined
Description: Legacy TreeBASE Matrix ID = M3016
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Strychnos nux-vomica |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Spigelia anthelmia |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Periploca graeca |
(none)
|
AAGTGTTGGATTCAAAGCCGGTGTTAAAGA |
Ophiorrhiza mungos |
(none)
|
AAGTGTTGGATTCAAAGGTGGTGTTAAAGA |
Nerium oleander |
(none)
|
AAGTGTTGGATTCAAAGCCGGTGTTAAAGA |
Mostuea brunonis |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Kopsia fruticosa |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Gentiana procera |
(none)
|
------------------------------ |
Gelsemium sempervirens |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Gelsemium rankinii |
(none)
|
-----------------------TTAAAGA |
Gelsemium elegans |
(none)
|
CAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Gardenia thunbergia |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Exacum affine |
(none)
|
------------------------------ |
Cinchona pubescens |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Antonia ovata |
(none)
|
----GTTGGATTCAAAGCTGGTGTTAAAGA |
Anthocleista grandiflora |
(none)
|
AAGTGTTGGATTCAAAGCTGGTGTTAAAGA |
Columns
None of the columns has a description.