@ARTICLE{TreeBASE2Ref16004,
author = {Zhen Jiao and Jianhua Li},
title = {Phylogeny and biogeography of intercontinental disjunct Gelsemiaceae inferred from chloroplast and nuclear DNA sequences},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Gelsemiaceae consist of two intercontinental disjunct genera: Gelsemium (3 species) and Mostuea (9 species). Gelsemium is distributed in eastern Asia and North America, while Mostuea is disjunct between South America and Africa. In this study, sequences of three chloroplast genes (ndhF, rbcL, and matK) and the external transcribed spacer of the ribosomal DNA region were used to examine phylogenetic relationships and biogeography of Gelsemiaceae. Our results support the monophyly of Gelsemiaceae, Mostuea, and Gelsemium; however, more data are needed to resolve relationships of Gelsemiaceae with other families of Gentianales. Within Mostuea, M. surinamensis of South America is sister to the clade containing African species, indicating that it is unlikely that M. surinamensis is an introduced species from Africa. The relationship agrees with seed pubescence. North American species of Gelsemium form a clade that is sister to G. elegans of eastern Asia, which is consistent with flower and fruit morphology. The estimated times of divergence are at least 21.2?0.7 mya between Gelsemium and Mostuea, 8.4?0.8 mya between eastern Asian and North American species of Gelsemium, 2.9?0.4 mya between G. sempervirens and G. rankinii, and 7.29?0.4 between South American and African species of Mostuea. Similar divergence times between the two intercontinental disjunctions support the proposition that Laurasian migration has played an important role in the formation of Gondwanan disjunctions. Given the broadleaved growth habit and ecology of Gelsemiaceae, the North Atlantic land bridge may be the main route for population exchanges between the continents.}
}
Matrix 925 of Study 1703
Citation title:
"Phylogeny and biogeography of intercontinental disjunct Gelsemiaceae inferred from chloroplast and nuclear DNA sequences".
This study was previously identified under the legacy study ID S1666
(Status: Published).
Matrices
Title: rDNA ETS
Description: Legacy TreeBASE Matrix ID = M3017
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Gelsemium rankinii 4341 |
(none)
|
TGCAGGATCCAACCAGGTAGCATTCCTCAC |
Gelsemium rankinii 4340 |
(none)
|
TGCAGGATCCAACCAGGTAGCATTCCTCAC |
Gelsemium rankinii 4338 |
(none)
|
TGCAGGATCCAACCAGGTAGCATTCCTCAC |
Gelsemium rankinii 4374 |
(none)
|
?????????????????????????????? |
Gelsemium rankinii 4370 |
(none)
|
TGCAGGATCCAAACCCGTAGCATTCCTCAC |
Gelsemium elegans 4173 |
(none)
|
?????????????????????????????? |
Gelsemium elegans 4162 |
(none)
|
TGCAGGATCAAACCAGGTAGCATTCCTCAC |
Gelsemium sempervirens 4188 |
(none)
|
?????????????????????????????? |
Gelsemium sempervirens 4186 |
(none)
|
?????????????????????????????? |
Mostuea hirsuta |
(none)
|
TGCAGGATC-AACCAGGTAGCATTCCTCAC |
Mostuea surinamensis |
(none)
|
TGCAGGATC-AACCAGGTAGCATTCCT-AC |
Mostuea batsii |
(none)
|
TGCAGGATC-AACCAGGTAGCATTCCTCAT |
Strychnos spinosa |
(none)
|
TGCAGGATCCAACCAGGTAGCATTCCTCAC |
Periploca sepium |
(none)
|
TGCAGGATC-AACCAGGTAGCATTCCTCAG |
Columns
None of the columns has a description.