@ARTICLE{TreeBASE2Ref19905,
author = {Kaoru Yamaguchi and Yasuhisa Tsurumi and Rieko Suzuki and Charuwan Chuaseeharonnachai and Veera - Sri-indrasutdhi and Nattawut - Boonyuen and Izumi Okane and Ken-ichiro Suzuki and Akira Nakagiri},
title = {Trichoderma matsushimae and T. aeroaquaticum: two aero-aquatic species with Pseudaegerita-like propagules},
year = {2012},
keywords = {evolution, freshwater, Hamatum clade, Hypocreales, systematics, tef1-int4},
doi = {10.3852/11-253},
url = {http://},
pmid = {},
journal = {Mycologia},
volume = {104},
number = {5},
pages = {1109--1120},
abstract = {Four isolates tentatively identified as Pseudaegerita matsushimae on the basis of the morphology of bulbil-like propagules were collected from substrates submerged in water in Thailand and Japan. In culture studies the two Thai isolates were found to produce phialoconidia on conidiogenous cells and phialoconidiophores whose morphology was similar to that of Trichoderma. Phylogenetic analysis based on D1/D2 regions of LSU rDNA sequences showed that the four isolates were nested in Hypocrea/Trichoderma (Hypocreales) while P. corticalis, the type species of Pseudaegerita, belongs to Hyaloscypha (Helotiales). Preliminary analysis by ISTH web tools based on 5.8S-ITS rDNA and phylogenetic analysis based on rpb2 and tef1-int4 genes showed that the isolates have specific sequences of Trichoderma (anchors 1?5) and belong to the Hamatum clade but they grouped apart from any known species of Trichoderma. The sequences of the tef1-int4 gene, which were amplified from the authentic specimen of P. matsushimae (IMI 266915), also showed that it belongs to the Hamatum clade closely clustering with T. yunnanense but separate from our four isolates. The morphology of P. matsushimae (IMI 266915), especially the sizes of phialides and phialoconidia, were different from T. yunnanense. Thus, we conclude that IMI 266915 and our isolates are to be assigned to two different species in the Hamatum clade of Trichoderma, although both species have similar morphology of bulbils and phialoconidia. Morphology and molecular data revealed that P. matsushimae should be assigned to the genus Trichoderma as T. matsushimae and the Thai and Japanese isolates are placed in T. aeroaquaticum sp. nov. This finding supports the interpretation that aero-aquatic fungi have evolved from terrestrial fungi. We assume that these fungi probably were derived from typically soil-inhabiting species of Trichoderma; an adaptation to aquatic environments is shown by formation of bulbil-like propagules floating on water.}
}
Matrix 9930 of Study 11768
Citation title:
"Trichoderma matsushimae and T. aeroaquaticum: two aero-aquatic species with Pseudaegerita-like propagules".
Study name:
"Trichoderma matsushimae and T. aeroaquaticum: two aero-aquatic species with Pseudaegerita-like propagules".
This study is part of submission 11768
(Status: Published).
Matrices
Title: Fig33-RPB2
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Trichoderma koningii CBS 119500 FJ860541 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma atroviride CBS 142 95 EU341801 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma hamatum DAOM 167057 isth764 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma pubescens DAOM 166162 isth760 |
(none)
|
TGGGGTGACCAGAAGAAGGCTATGAGCTCG |
Trichoderma evansii CBS 123079 EU883558 |
(none)
|
TGGGGTGACCAGAAGAAGGCTATGAGCTCG |
Hypocrea flaviconidia GJS 99 49 EU883557 |
(none)
|
TGGGGTGACCAGAAGAAGGCCATGAGCTCG |
Trichoderma lieckfeldtiae CBS 123050 EU883561 |
(none)
|
TGGGGTGACCAGAAGAAGGCTATGAGCTCG |
Hypocrea neorufa GJS 96 132 HQ260621 |
(none)
|
TGGGGTGATCAGAAGAAGGCAATGAGCTCG |
Trichoderma paucisporum GJS 01 13 FJ150787 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma theobromicola DIS 85f FJ007374 |
(none)
|
TGGGGTGACCAGAAAAAGGCAATGAGCTCG |
Trichoderma asperellum GJS 90 7 EU338337 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma yunnanense CBS 121219 GU198274 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma asperelloides GJS 04 116 GU248411 |
(none)
|
TGGGGTGACCAGAAGAAGGCAATGAGCTCG |
Trichoderma sp. NBRC 108035 |
(none)
|
TGGGGTGACCAGAAAAAGGCAATGAGCTCG |
Trichoderma sp. NBRC 108036 |
(none)
|
TGGGGTGACCAGAAAAAGGCAATGAGCTCG |
Trichoderma sp. NBRC 108034 |
(none)
|
TGGGGTGACCAGAAAAAGGCAATGAGCTCG |
Trichoderma sp. NBRC 108031 |
(none)
|
TGGGGTGACCAGAAAAAGGCAATGAGCTCG |
Hypocrea pezizoides GJS 01 231 isth750 |
(none)
|
TGGGGCGATCAGAAAAAGGCAATGAGCTCG |
Columns
None of the columns has a description.